Maize B73 small RNA miRNA Abundances

The data below are based on the microRNAs listed in the miRBase registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  1_A6192_A6193_A6194_A6195_A6191_fzt2_fzt3_fzt4_fzt5_fzt1T_A6192T_A6193T_A6191T_fzt2T_fzt3T_fzt
zma-miR11969-3p UUAUACCCAUCUCUCACCUUGCAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR11969-5p GCAAGGUCAGAGAAGGAUAUAAUC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR11970-3p UGGUUUGGUUGCACGUUUGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR11970-5p CAAGCGUGCAAGCAAACCAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR1432-3p GGGUGUCAUCUCGCCUGAAGCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR1432-5p CUCAGGAGAGAUGACACCGAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR156a-3p GCUCACUUCUCUCUCUGUCAGU 22 159 10 48 1    5 3 48 29 42 26 0 5 1 0 0 0 0 0 0 0
zma-miR156a-5p UGACAGAAGAGAGUGAGCAC 20 2,664,952 166,560 1,677,833 1    1,677,833 272,007 21,290 3,972 11,981 588,449 66,865 9,841 9,480 3,178 17 9 10 18 1 1
zma-miR156b-3p GCUCACCCUCUAUCUGUCAGU 21 937 59 386 5    0 18 386 37 97 26 17 176 175 5 0 0 0 0 0 0
zma-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 2,664,952 166,560 1,677,833 1    1,677,833 272,007 21,290 3,972 11,981 588,449 66,865 9,841 9,480 3,178 17 9 10 18 1 1
zma-miR156c UGACAGAAGAGAGUGAGCAC 20 2,664,952 166,560 1,677,833 1    1,677,833 272,007 21,290 3,972 11,981 588,449 66,865 9,841 9,480 3,178 17 9 10 18 1 1
zma-miR156d-3p GCUCACUUCUCUUUCUGUCAGC 22 20,099 1,256 6,564 1    6,360 4,727 848 174 333 6,564 953 87 28 15 7 1 0 2 0 0
zma-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 2,664,952 166,560 1,677,833 1    1,677,833 272,007 21,290 3,972 11,981 588,449 66,865 9,841 9,480 3,178 17 9 10 18 1 1
zma-miR156e-3p GCUCACUGCUCUCUCUGUCAUC 22 237 15 110 1    5 4 110 20 44 29 1 16 4 2 0 0 1 1 0 0
zma-miR156e-5p UGACAGAAGAGAGUGAGCAC 20 2,664,952 166,560 1,677,833 1    1,677,833 272,007 21,290 3,972 11,981 588,449 66,865 9,841 9,480 3,178 17 9 10 18 1 1
zma-miR156f-3p GCUCACUUCUCUUUCUGUCAGC 22 20,099 1,256 6,564 1    6,360 4,727 848 174 333 6,564 953 87 28 15 7 1 0 2 0 0
zma-miR156f-5p UGACAGAAGAGAGUGAGCAC 20 2,664,952 166,560 1,677,833 1    1,677,833 272,007 21,290 3,972 11,981 588,449 66,865 9,841 9,480 3,178 17 9 10 18 1 1
zma-miR156g-3p GCUCACUUCUCUUUCUGUCAGC 22 20,099 1,256 6,564 1    6,360 4,727 848 174 333 6,564 953 87 28 15 7 1 0 2 0 0
zma-miR156g-5p UGACAGAAGAGAGUGAGCAC 20 2,664,952 166,560 1,677,833 1    1,677,833 272,007 21,290 3,972 11,981 588,449 66,865 9,841 9,480 3,178 17 9 10 18 1 1
zma-miR156h-3p GCUCACUGCUCUUUCUGUCAUC 22 635 40 196 1    196 94 58 10 13 189 43 14 15 2 1 0 0 0 0 0
zma-miR156h-5p UGACAGAAGAGAGUGAGCAC 20 2,664,952 166,560 1,677,833 1    1,677,833 272,007 21,290 3,972 11,981 588,449 66,865 9,841 9,480 3,178 17 9 10 18 1 1
zma-miR156i-3p GCUCACUGCUCUAUCUGUCAUC 22 1,093 68 597 2    373 62 30 3 5 597 12 7 2 2 0 0 0 0 0 0
zma-miR156i-5p UGACAGAAGAGAGUGAGCAC 20 2,664,952 166,560 1,677,833 1    1,677,833 272,007 21,290 3,972 11,981 588,449 66,865 9,841 9,480 3,178 17 9 10 18 1 1
zma-miR156j-3p UGCUCUCUGCUCUCACUGUCAUC 23 1 0 1 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0
zma-miR156j-5p UGACAGAAGAGAGAGAGCACA 21 2 0 2 2    2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR156k-3p GCUCGCUUCUCUUUCUGUCAGC 22 516 32 137 3    128 50 61 36 45 137 13 19 6 13 5 0 0 3 0 0
zma-miR156k-5p UGACAGAAGAGAGCGAGCAC 20 38,000 2,375 22,681 1    22,681 3,069 219 40 133 10,765 927 90 25 43 3 1 1 2 1 0
zma-miR156l-3p GCUCACUGCUCUAUCUGUCACC 22 7,331 458 3,815 1    1,374 756 452 126 203 3,815 395 118 47 43 0 1 0 1 0 0
zma-miR156l-5p UGACAGAAGAGAGUGAGCAC 20 2,664,952 166,560 1,677,833 1    1,677,833 272,007 21,290 3,972 11,981 588,449 66,865 9,841 9,480 3,178 17 9 10 18 1 1
zma-miR159a-3p UUUGGAUUGAAGGGAGCUCUG 21 17,050 1,066 3,124 106    575 3,124 1,931 505 839 1,895 334 664 225 106 1,631 2,332 1,674 188 642 385
zma-miR159a-5p GAGCUCCUAUCAUUCCAAUGA 21 1,631 102 960 3    0 0 209 16 27 7 0 24 3 4 960 80 114 160 5 22
zma-miR159b-3p UUUGGAUUGAAGGGAGCUCUG 21 17,050 1,066 3,124 106    575 3,124 1,931 505 839 1,895 334 664 225 106 1,631 2,332 1,674 188 642 385
zma-miR159b-5p GUGCUCCCUUCAAACCAAUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159c-3p CUUGGAUUGAAGGGAGCUCCU 21 27 2 7 1    0 0 4 7 7 0 0 1 2 1 1 1 1 1 1 0
zma-miR159c-5p GAGCUCCCUUCGAUCCAAUCC 21 7 0 4 1    0 0 4 0 2 0 0 0 0 0 0 0 0 1 0 0
zma-miR159d-3p CUUGGAUUGAAGGGAGCUCCU 21 27 2 7 1    0 0 4 7 7 0 0 1 2 1 1 1 1 1 1 0
zma-miR159d-5p GAGCUCCCUUCGAUCCAAUCC 21 7 0 4 1    0 0 4 0 2 0 0 0 0 0 0 0 0 1 0 0
zma-miR159e-3p AUUGGUUUGAAGGGAGCUCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159e-5p CAGCUCCUGCAGCAUCUGUUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159f-3p UUUGGAUUGAAGGGAGCUCUG 21 17,050 1,066 3,124 106    575 3,124 1,931 505 839 1,895 334 664 225 106 1,631 2,332 1,674 188 642 385
zma-miR159f-5p GAGCUCCUCUCAUUCCAAUGA 21 54 3 20 1    6 0 20 3 8 7 0 0 0 0 5 1 3 1 0 0
zma-miR159g-3p UUUGGAGUGAAGGGAGUUCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159g-5p GUGCUCCCUUCACACCAAUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159h-3p UUUGGAGUGAAGGGAGCUCUG 21 9 1 3 1    0 0 0 0 0 0 0 0 0 0 2 1 3 1 1 1
zma-miR159h-5p GUGCUCCCUUCACACCAAUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159i-3p UUUGGAGUGAAGGGAGCUCUG 21 9 1 3 1    0 0 0 0 0 0 0 0 0 0 2 1 3 1 1 1
zma-miR159i-5p GUGCUCCCUUCACACCAAUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159j-3p UUUGGAUUGAAGGGAGCUCUG 21 17,050 1,066 3,124 106    575 3,124 1,931 505 839 1,895 334 664 225 106 1,631 2,332 1,674 188 642 385
zma-miR159j-5p GUGCUCCCUUCAAACCAAUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159k-3p UUUGGAUUGAAGGGAGCUCUG 21 17,050 1,066 3,124 106    575 3,124 1,931 505 839 1,895 334 664 225 106 1,631 2,332 1,674 188 642 385
zma-miR159k-5p GUGCUCCCUUCAAACCAAUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR160a-3p GCGUGCAAGGGGCCAAGCAUG 21 59 4 16 1    8 11 13 1 3 16 1 3 1 1 1 0 0 0 0 0
zma-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 8,945 559 5,059 13    381 637 5,059 101 261 1,295 209 516 34 73 127 108 76 13 27 28
zma-miR160b-3p GCGUGCAAGGAGCCAAGCAUG 21 836 52 363 3    363 8 79 3 6 153 6 20 5 4 88 7 12 72 4 6
zma-miR160b-5p UGCCUGGCUCCCUGUAUGCCA 21 8,945 559 5,059 13    381 637 5,059 101 261 1,295 209 516 34 73 127 108 76 13 27 28
zma-miR160c-3p GCGUGCAUGGUGCCAAGCAUA 21 9 1 6 1    0 1 6 0 0 0 0 1 0 0 0 0 0 1 0 0
zma-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 8,945 559 5,059 13    381 637 5,059 101 261 1,295 209 516 34 73 127 108 76 13 27 28
zma-miR160d-3p GCGUGCGUGGAGCCAAGCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR160d-5p UGCCUGGCUCCCUGUAUGCCA 21 8,945 559 5,059 13    381 637 5,059 101 261 1,295 209 516 34 73 127 108 76 13 27 28
zma-miR160e UGCCUGGCUCCCUGUAUGCCA 21 8,945 559 5,059 13    381 637 5,059 101 261 1,295 209 516 34 73 127 108 76 13 27 28
zma-miR160f-3p GCGUGCGAGGUGCCAGGCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR160f-5p UGCCUGGCUCCCUGUAUGCCG 21 85 5 50 1    50 0 22 1 1 3 0 4 0 1 2 1 0 0 0 0
zma-miR160g-3p GCGUGCAAGGAGCCAAGCAUG 21 836 52 363 3    363 8 79 3 6 153 6 20 5 4 88 7 12 72 4 6
zma-miR160g-5p UGCCUGGCUCCCUGUAUGCCA 21 8,945 559 5,059 13    381 637 5,059 101 261 1,295 209 516 34 73 127 108 76 13 27 28
zma-miR162-3p UCGAUAAACCUCUGCAUCCA 20 30 2 10 2    2 0 10 0 2 3 0 0 0 0 8 2 3 0 0 0
zma-miR162-5p GGGCGCAGUGGUUUAUCGAUC 21 13 1 5 1    0 0 4 1 1 0 0 0 0 0 5 1 1 0 0 0
zma-miR164a-3p CACGUGUUCUCCUUCUCCAUC 21 163 10 64 1    0 0 4 0 1 0 0 2 2 0 64 7 11 62 6 4
zma-miR164a-5p UGGAGAAGCAGGGCACGUGCA 21 17,376 1,086 10,145 18    4,547 782 906 18 77 10,145 135 291 37 30 103 59 50 131 26 39
zma-miR164b-3p AUGUGCCCAUCUUCUCCACC 20 184 12 121 1    0 0 121 6 20 3 0 22 6 5 1 0 0 0 0 0
zma-miR164b-5p UGGAGAAGCAGGGCACGUGCA 21 17,376 1,086 10,145 18    4,547 782 906 18 77 10,145 135 291 37 30 103 59 50 131 26 39
zma-miR164c-3p CAUGUGCCCUUCUUCUCCAUC 21 181 11 120 1    0 0 120 1 27 3 0 13 14 0 1 0 1 1 0 0
zma-miR164c-5p UGGAGAAGCAGGGCACGUGCA 21 17,376 1,086 10,145 18    4,547 782 906 18 77 10,145 135 291 37 30 103 59 50 131 26 39
zma-miR164d-3p CACGUGGUCUCCUUCUCCAU 20 2 0 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0
zma-miR164d-5p UGGAGAAGCAGGGCACGUGCA 21 17,376 1,086 10,145 18    4,547 782 906 18 77 10,145 135 291 37 30 103 59 50 131 26 39
zma-miR164e-3p CAUGUGUCCGCCCUCUCCACC 21 12 1 3 1    0 0 3 3 2 0 0 0 3 0 1 0 0 0 0 0
zma-miR164e-5p UGGAGAAGCAGGACACGUGAG 21 2,592 162 1,578 1    1,578 395 12 3 9 492 95 4 2 0 1 0 0 1 0 0
zma-miR164f-3p CACGUGCGCUCCUUCUCCAAC 21 6 0 2 1    0 0 2 2 1 0 0 1 0 0 0 0 0 0 0 0
zma-miR164f-5p UGGAGAAGCAGGGCACGUGCU 21 425 27 175 1    175 80 15 1 5 134 10 3 1 0 1 0 0 0 0 0
zma-miR164g-3p CACGUGCUCCCCUUCUCCACC 21 880 55 337 1    0 0 100 1 11 0 0 3 6 0 151 35 97 337 56 83
zma-miR164g-5p UGGAGAAGCAGGGCACGUGCA 21 17,376 1,086 10,145 18    4,547 782 906 18 77 10,145 135 291 37 30 103 59 50 131 26 39
zma-miR164h-3p CAUGUGCCCUUCUUCUCCAUC 21 181 11 120 1    0 0 120 1 27 3 0 13 14 0 1 0 1 1 0 0
zma-miR164h-5p UGGAGAAGCAGGGCACGUGUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 2,800,985 175,062 391,974 35,496    45,453 289,052 324,460 114,312 196,590 35,496 198,944 355,108 295,347 117,283 391,974 98,353 56,042 202,818 38,238 41,515
zma-miR166a-5p GGAAUGUUGUCUGGCUCGGGG 21 913 57 192 4    26 22 29 47 64 143 4 19 18 13 141 69 41 192 43 42
zma-miR166b-3p UCGGACCAGGCUUCAUUCCC 20 28,336 1,771 7,038 199    337 855 3,173 425 1,096 199 641 2,843 1,814 593 7,038 1,227 769 6,195 494 637
zma-miR166b-5p GGAAUGUUGUCUGGUUCAAGG 21 4,248 266 743 2    42 3 594 327 423 33 2 433 312 153 743 392 185 417 94 95
zma-miR166c-3p UCGGACCAGGCUUCAUUCCC 20 28,336 1,771 7,038 199    337 855 3,173 425 1,096 199 641 2,843 1,814 593 7,038 1,227 769 6,195 494 637
zma-miR166c-5p GGAAUGUUGUCUGGCUCGAGG 21 1,327 83 626 10    146 84 54 28 52 626 27 30 32 12 93 42 34 41 16 10
zma-miR166d-3p UCGGACCAGGCUUCAUUCCC 20 28,336 1,771 7,038 199    337 855 3,173 425 1,096 199 641 2,843 1,814 593 7,038 1,227 769 6,195 494 637
zma-miR166d-5p GGAAUGUUGUCUGGUUCAAGG 21 4,248 266 743 2    42 3 594 327 423 33 2 433 312 153 743 392 185 417 94 95
zma-miR166e UCGGACCAGGCUUCAUUCCC 20 28,336 1,771 7,038 199    337 855 3,173 425 1,096 199 641 2,843 1,814 593 7,038 1,227 769 6,195 494 637
zma-miR166f UCGGACCAGGCUUCAUUCCC 20 28,336 1,771 7,038 199    337 855 3,173 425 1,096 199 641 2,843 1,814 593 7,038 1,227 769 6,195 494 637
zma-miR166g-3p UCGGACCAGGCUUCAUUCCC 20 28,336 1,771 7,038 199    337 855 3,173 425 1,096 199 641 2,843 1,814 593 7,038 1,227 769 6,195 494 637
zma-miR166g-5p GGAAUGUUGUCUGGUUGGAGA 21 275 17 82 1    11 1 30 1 8 3 3 49 82 4 12 4 3 47 10 7
zma-miR166h-3p UCGGACCAGGCUUCAUUCCC 20 28,336 1,771 7,038 199    337 855 3,173 425 1,096 199 641 2,843 1,814 593 7,038 1,227 769 6,195 494 637
zma-miR166h-5p GGAAUGACGUCCGGUCCGAAC 21 2 0 2 2    0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR166i-3p UCGGACCAGGCUUCAUUCCC 20 28,336 1,771 7,038 199    337 855 3,173 425 1,096 199 641 2,843 1,814 593 7,038 1,227 769 6,195 494 637
zma-miR166i-5p GGAAUGUCGUCUGGCGCGAGA 21 13 1 4 1    0 4 1 0 1 0 1 0 0 0 2 0 1 2 0 1
zma-miR166j-3p UCGGACCAGGCUUCAAUCCCU 21 44,617 2,789 9,947 84    3,130 9,947 3,207 151 782 890 1,865 656 331 84 7,195 5,416 5,401 2,123 1,481 1,958
zma-miR166j-5p GGUUUGUUUGUCUGGUUCAAGG 22 18 1 5 1    0 1 5 1 5 0 0 2 2 0 0 0 1 0 0 1
zma-miR166k-3p UCGGACCAGGCUUCAAUCCCU 21 44,617 2,789 9,947 84    3,130 9,947 3,207 151 782 890 1,865 656 331 84 7,195 5,416 5,401 2,123 1,481 1,958
zma-miR166k-5p GGAUUGUUGUCUGGCUCGGGG 21 1,134 71 521 1    0 0 1 0 0 3 1 2 1 0 521 67 81 373 32 52
zma-miR166l-3p UCGGACCAGGCUUCAUUCCUC 21 80,347 5,022 14,464 155    4,542 14,464 3,464 155 771 2,436 10,396 1,953 1,178 352 10,958 5,822 5,024 10,216 4,037 4,579
zma-miR166l-5p GAAUGGAGGCUGGUCCAAGA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR166m-3p UCGGACCAGGCUUCAUUCCUC 21 80,347 5,022 14,464 155    4,542 14,464 3,464 155 771 2,436 10,396 1,953 1,178 352 10,958 5,822 5,024 10,216 4,037 4,579
zma-miR166m-5p GGAAUGUUGGCUGGCUCGAGG 21 1,519 95 326 2    65 64 39 0 2 326 62 19 29 0 235 118 76 320 94 70
zma-miR166n-3p UCGGACCAGGCUUCAAUCCCU 21 44,617 2,789 9,947 84    3,130 9,947 3,207 151 782 890 1,865 656 331 84 7,195 5,416 5,401 2,123 1,481 1,958
zma-miR166n-5p GGAUUGUUGUCUGGCUCGGUG 21 3,028 189 1,193 1    8 1 35 0 12 68 2 15 29 0 1,193 269 309 870 69 148
zma-miR167a-3p GAUCAUGCAUGACAGCCUCAUU 22 37 2 11 1    0 0 5 1 0 0 0 1 0 2 11 4 8 2 1 2
zma-miR167a-5p UGAAGCUGCCAGCAUGAUCUA 21 6,199 387 2,952 5    2,952 423 594 28 64 721 39 32 5 6 427 418 446 20 11 13
zma-miR167b-3p GAUCAUGCUGUGACAGUUUCACU 23 116 7 70 1    3 3 70 17 17 0 1 4 0 1 0 0 0 0 0 0
zma-miR167b-5p UGAAGCUGCCAGCAUGAUCUA 21 6,199 387 2,952 5    2,952 423 594 28 64 721 39 32 5 6 427 418 446 20 11 13
zma-miR167c-3p GAUCAUGCUGUGGCAGCCUCACU 23 4,068 254 1,422 3    818 97 258 48 70 1,422 14 11 3 4 281 364 562 18 42 56
zma-miR167c-5p UGAAGCUGCCAGCAUGAUCUA 21 6,199 387 2,952 5    2,952 423 594 28 64 721 39 32 5 6 427 418 446 20 11 13
zma-miR167d-3p GGUCAUGCUGCUGCAGCCUCACU 23 910 57 329 1    212 94 141 7 11 329 0 0 0 0 47 28 38 1 1 1
zma-miR167d-5p UGAAGCUGCCAGCAUGAUCUA 21 6,199 387 2,952 5    2,952 423 594 28 64 721 39 32 5 6 427 418 446 20 11 13
zma-miR167e-3p GAUCAUGCUGUGCAGUUUCAUC 22 988 62 527 1    527 87 94 10 20 166 48 26 4 5 0 1 0 0 0 0
zma-miR167e-5p UGAAGCUGCCAGCAUGAUCUG 21 46,764 2,923 25,875 1    25,875 5,876 2,696 507 823 7,915 1,366 1,096 332 264 1 5 2 0 4 2
zma-miR167f-3p GAUCGUGCUGCGCAGUUUCACC 22 56 4 21 1    2 2 21 3 1 3 2 17 2 3 0 0 0 0 0 0
zma-miR167f-5p UGAAGCUGCCAGCAUGAUCUG 21 46,764 2,923 25,875 1    25,875 5,876 2,696 507 823 7,915 1,366 1,096 332 264 1 5 2 0 4 2
zma-miR167g-3p GGUCAUGCUGUAGUUUCAUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR167g-5p UGAAGCUGCCAGCAUGAUCUG 21 46,764 2,923 25,875 1    25,875 5,876 2,696 507 823 7,915 1,366 1,096 332 264 1 5 2 0 4 2
zma-miR167h-3p GAUCAUGUUGCAGCUUCAC 19 3 0 1 1    0 0 1 0 1 0 0 1 0 0 0 0 0 0 0 0
zma-miR167h-5p UGAAGCUGCCAGCAUGAUCUG 21 46,764 2,923 25,875 1    25,875 5,876 2,696 507 823 7,915 1,366 1,096 332 264 1 5 2 0 4 2
zma-miR167i-3p GAUCAUGUUGCAGCUUCAC 19 3 0 1 1    0 0 1 0 1 0 0 1 0 0 0 0 0 0 0 0
zma-miR167i-5p UGAAGCUGCCAGCAUGAUCUG 21 46,764 2,923 25,875 1    25,875 5,876 2,696 507 823 7,915 1,366 1,096 332 264 1 5 2 0 4 2
zma-miR167j-3p GAUCAUGUGGCAGUUUCAUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR167j-5p UGAAGCUGCCAGCAUGAUCUG 21 46,764 2,923 25,875 1    25,875 5,876 2,696 507 823 7,915 1,366 1,096 332 264 1 5 2 0 4 2
zma-miR168a-3p CCCGCCUUGCACCAAGUGAA 20 884 55 624 1    6 0 624 13 57 7 0 28 2 1 107 3 3 28 5 0
zma-miR168a-5p UCGCUUGGUGCAGAUCGGGAC 21 95,107 5,944 45,190 749    1,531 3,044 45,190 4,375 6,073 1,344 1,053 14,836 6,136 2,600 2,164 1,137 1,075 2,978 749 822
zma-miR168b-3p CCCGCCUUGCAUCAAGUGAA 20 759 47 419 1    2 0 419 29 67 3 0 26 6 2 131 3 2 65 3 1
zma-miR168b-5p UCGCUUGGUGCAGAUCGGGAC 21 95,107 5,944 45,190 749    1,531 3,044 45,190 4,375 6,073 1,344 1,053 14,836 6,136 2,600 2,164 1,137 1,075 2,978 749 822
zma-miR169a-3p GGCAAGUUGUUCUUGGCUACA 21 11 1 10 1    10 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
zma-miR169a-5p CAGCCAAGGAUGACUUGCCGA 21 4,943 309 2,991 1    2,991 337 19 5 2 1,428 150 6 0 0 2 1 2 0 0 0
zma-miR169b-3p GGCAAGUUGUUCUUGGCUACA 21 11 1 10 1    10 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
zma-miR169b-5p CAGCCAAGGAUGACUUGCCGA 21 4,943 309 2,991 1    2,991 337 19 5 2 1,428 150 6 0 0 2 1 2 0 0 0
zma-miR169c-3p GGCAAGUCUGUCCUUGGCUACA 22 601 38 187 1    11 0 129 66 187 52 3 80 45 21 4 1 1 0 1 0
zma-miR169c-5p CAGCCAAGGAUGACUUGCCGG 21 64,801 4,050 32,669 1    27,184 2,483 81 6 11 32,669 2,311 48 4 1 1 1 1 0 0 0
zma-miR169d UAGCCAAGGAGACUGCCUAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169e UAGCCAAGGAGACUGCCUACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169f-3p GGCAUGUCUUCCUUGGCUACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169f-5p UAGCCAAGGAUGACUUGCCUA 21 15,127 945 8,512 1    8,512 793 85 5 11 3,825 1,858 26 3 3 3 1 1 0 0 1
zma-miR169g UAGCCAAGGAUGACUUGCCUA 21 15,127 945 8,512 1    8,512 793 85 5 11 3,825 1,858 26 3 3 3 1 1 0 0 1
zma-miR169h UAGCCAAGGAUGACUUGCCUA 21 15,127 945 8,512 1    8,512 793 85 5 11 3,825 1,858 26 3 3 3 1 1 0 0 1
zma-miR169i-3p GGCAGUCUCCUUGGCUAG 18 60 4 23 1    23 1 12 1 0 0 1 13 3 1 2 1 1 1 0 0
zma-miR169i-5p UAGCCAAGGAUGACUUGCCUG 21 107,821 6,739 65,364 1    65,364 4,017 236 18 56 37,619 474 14 4 3 6 6 3 0 1 0
zma-miR169j-3p GGCAGUCUCCUUGGCUAG 18 60 4 23 1    23 1 12 1 0 0 1 13 3 1 2 1 1 1 0 0
zma-miR169j-5p UAGCCAAGGAUGACUUGCCUG 21 107,821 6,739 65,364 1    65,364 4,017 236 18 56 37,619 474 14 4 3 6 6 3 0 1 0
zma-miR169k-3p GGCAGUCUCCUUGGCUAG 18 60 4 23 1    23 1 12 1 0 0 1 13 3 1 2 1 1 1 0 0
zma-miR169k-5p UAGCCAAGGAUGACUUGCCUG 21 107,821 6,739 65,364 1    65,364 4,017 236 18 56 37,619 474 14 4 3 6 6 3 0 1 0
zma-miR169l-3p GGCAAAUCAUCCCUGCUACC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169l-5p UAGCCAGGGAUGAUUUGCCUG 21 12 1 4 1    2 0 0 0 0 3 0 4 1 0 0 0 0 0 1 1
zma-miR169m-3p GGCAUCCAUUCUUGGCUAAG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169m-5p UAGCCAAGAAUGGCUUGCCUA 21 7 0 5 1    5 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0
zma-miR169n-3p GGCAGGCCUUCUUGGCUAAG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169n-5p UAGCCAAGAAUGGCUUGCCUA 21 7 0 5 1    5 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0
zma-miR169o-3p GGCAGGUCUUCUUGGCUAGC 20 1 0 1 1    0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0
zma-miR169o-5p UAGCCAAGAAUGACUUGCCUA 21 495 31 324 1    324 22 1 0 0 124 23 0 1 0 0 0 0 0 0 0
zma-miR169p-3p GGCAAGUCAUCUGGGGCUACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169p-5p UAGCCAAGGAUGACUUGCCGG 21 695 43 501 1    501 41 0 2 0 114 11 0 0 0 12 8 5 1 0 0
zma-miR169q-3p GGCAGGCCUUCUGGCUAAG 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169q-5p UAGCCAAGAAUGGCUUGCCUA 21 7 0 5 1    5 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0
zma-miR169r-3p GGCAAGUUGUCCUUGGCUACA 21 14 1 5 1    0 0 5 4 4 0 0 0 1 0 0 0 0 0 0 0
zma-miR169r-5p CAGCCAAGGAUGACUUGCCGG 21 64,801 4,050 32,669 1    27,184 2,483 81 6 11 32,669 2,311 48 4 1 1 1 1 0 0 0
zma-miR171a-3p UGAUUGAGCCGCGCCAAUAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171a-5p UAUUGGCGAGGUUCAAUCAGA 21 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171b-3p UUGAGCCGUGCCAAUAUCAC 20 5 0 3 1    3 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0
zma-miR171b-5p GAUAUUGGCGCGGUUCAAUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171c-3p UGACUGAGCCGUGCCAAUAUC 21 33 2 16 1    16 1 1 1 0 13 1 0 0 0 0 0 0 0 0 0
zma-miR171c-5p UAUUGGUGCGGUUCAAUCAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171d-3p UGAUUGAGCCGUGCCAAUAUC 21 20,551 1,284 9,064 34    9,064 1,318 746 63 197 7,253 1,079 303 68 44 114 82 75 61 34 50
zma-miR171d-5p UGUUGGCUCGGCUCACUCAGA 21 6,243 390 1,686 1    1,087 1,668 313 1 43 1,686 867 108 54 4 136 58 65 87 27 39
zma-miR171e-3p UGAUUGAGCCGUGCCAAUAUC 21 20,551 1,284 9,064 34    9,064 1,318 746 63 197 7,253 1,079 303 68 44 114 82 75 61 34 50
zma-miR171e-5p UGUUGGCUCGGCUCACUCAGA 21 6,243 390 1,686 1    1,087 1,668 313 1 43 1,686 867 108 54 4 136 58 65 87 27 39
zma-miR171f-3p UUGAGCCGUGCCAAUAUCACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171f-5p CGAUGUUGGCAUGGCUCAAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171g-3p GAGGUGAGCCGAGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171g-5p UAUUGACUUGGCUCAUCUCUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171h-3p GUGAGCCGAACCAAUAUCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171h-5p UGGUAUUGUUUCGGCUCAUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171i-3p UGAUUGAGCCGUGCCAAUAUC 21 20,551 1,284 9,064 34    9,064 1,318 746 63 197 7,253 1,079 303 68 44 114 82 75 61 34 50
zma-miR171i-5p UGUUGGCACGGUUCAAUCAAA 21 18 1 7 1    3 0 5 1 1 7 0 1 0 0 0 0 0 0 0 0
zma-miR171j-3p UGAUUGAGCCGUGCCAAUAUC 21 20,551 1,284 9,064 34    9,064 1,318 746 63 197 7,253 1,079 303 68 44 114 82 75 61 34 50
zma-miR171j-5p UAUUGACGCGGUUCAAUUCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171k-3p GUGAGCCGAACCAAUAUCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171k-5p UGGUAUUGUUUCGGCUCAUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171l-3p GGAUUGAGCCGCGUCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171l-5p UAUUGGCGUGCCUCAAUCCGA 21 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171m-3p GGAUUGAGCCGCGUCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171m-5p UAUUGGCGCGCCUCAAUCCGA 21 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171n-3p UGAUUGAGCCGCGCCAAUAUC 21 23 1 8 1    8 1 3 0 0 7 1 2 1 0 0 0 0 0 0 0
zma-miR171n-5p UAUUGGUGAGGUUCAAUCCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR172a AGAAUCUUGAUGAUGCUGCA 20 602 38 439 1    439 65 0 0 0 88 8 1 0 0 1 0 0 0 0 0
zma-miR172b-3p AGAAUCUUGAUGAUGCUGCA 20 602 38 439 1    439 65 0 0 0 88 8 1 0 0 1 0 0 0 0 0
zma-miR172b-5p CAGCACCAUCAAGAUUCACA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR172c-3p AGAAUCUUGAUGAUGCUGCA 20 602 38 439 1    439 65 0 0 0 88 8 1 0 0 1 0 0 0 0 0
zma-miR172c-5p CAGCACCACCAAGAUUCACA 20 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR172d-3p AGAAUCUUGAUGAUGCUGCA 20 602 38 439 1    439 65 0 0 0 88 8 1 0 0 1 0 0 0 0 0
zma-miR172d-5p CAGCACCAUCAAGAUUCACA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR172e GGAAUCUUGAUGAUGCUGCAU 21 11,513 720 7,658 1    7,658 1,279 10 0 0 2,439 43 0 0 0 37 24 20 1 1 1
zma-miR2118a UUCCUGAUGCCUCUCAUUCCUA 22 5 0 4 1    0 0 4 0 0 0 0 0 1 0 0 0 0 0 0 0
zma-miR2118b UUCCCGAUGCCUCCCAUUCCUA 22 218 14 124 1    0 0 124 23 27 0 0 13 13 3 5 5 2 0 1 2
zma-miR2118c UUCCUAAUGCCUCCCAUUCCUA 22 1 0 1 1    0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0
zma-miR2118d UUCCUGAUGCCUCCCAUGCCUA 22 53 3 26 1    0 0 26 3 5 0 0 9 0 0 7 0 1 1 0 1
zma-miR2118e UUCCUGAUGUCUCCCAUUCCUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR2118f UUCCCAAUGCCUUCCAUGCCUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR2118g UUCCUGAUGCCUCCUAUUCCUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR2275a-3p UUUGUUUUCCUCCAAUAUCUCA 22 9 1 3 1    0 0 2 0 0 0 0 0 0 0 3 1 0 1 1 1
zma-miR2275a-5p AGAGUUGGAGGAAAGCAAACC 21 15 1 4 1    0 0 4 1 0 0 0 1 3 0 3 0 0 1 1 1
zma-miR2275b-3p UUCAGUUUCCUCUAAUAUCUCA 22 6 0 2 1    2 0 2 0 1 0 0 0 0 0 0 0 0 1 0 0
zma-miR2275b-5p AGGAUUAGAGGCAACUGAACC 21 51 3 14 1    13 1 14 1 7 0 0 1 2 0 9 1 1 1 0 0
zma-miR2275c-3p UUCAGUUUCCUCUAAUAUCUCA 22 6 0 2 1    2 0 2 0 1 0 0 0 0 0 0 0 0 1 0 0
zma-miR2275c-5p AGGAUUAGAGGGACUUGAACC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR2275d-3p UUUGUUUUCCUCUAAUAUCUCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR2275d-5p AGAGUUGGAGGAAAGAAAACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR319a-3p UUGGACUGAAGGGUGCUCCC 20 10,500 656 3,213 20    198 162 3,213 131 233 313 20 578 302 24 2,079 1,212 1,386 484 89 76
zma-miR319a-5p GAGCUCUCUUCAGUCCACUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR319b-3p UUGGACUGAAGGGUGCUCCC 20 10,500 656 3,213 20    198 162 3,213 131 233 313 20 578 302 24 2,079 1,212 1,386 484 89 76
zma-miR319b-5p AGAGCGUCCUUCAGUCCACUC 21 2,625 164 1,097 1    313 304 1,097 157 239 316 26 58 37 6 24 1 1 45 1 0
zma-miR319c-3p UUGGACUGAAGGGUGCUCCC 20 10,500 656 3,213 20    198 162 3,213 131 233 313 20 578 302 24 2,079 1,212 1,386 484 89 76
zma-miR319c-5p GAGCUCUCUUCAGUCCACUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR319d-3p UUGGACUGAAGGGUGCUCCC 20 10,500 656 3,213 20    198 162 3,213 131 233 313 20 578 302 24 2,079 1,212 1,386 484 89 76
zma-miR319d-5p AGAGCGUCCUUCAGUCCACUC 21 2,625 164 1,097 1    313 304 1,097 157 239 316 26 58 37 6 24 1 1 45 1 0
zma-miR390a-3p CGCUAUCUAUCCUGAGCUCCA 21 270 17 63 1    63 4 28 1 2 46 10 14 12 2 30 13 6 26 7 6
zma-miR390a-5p AAGCUCAGGAGGGAUAGCGCC 21 14,215 888 5,407 35    1,685 43 2,566 101 660 5,407 35 973 337 145 1,124 187 219 536 69 128
zma-miR390b-3p CGCUAUCUAUCCUGAGCUCCA 21 270 17 63 1    63 4 28 1 2 46 10 14 12 2 30 13 6 26 7 6
zma-miR390b-5p AAGCUCAGGAGGGAUAGCGCC 21 14,215 888 5,407 35    1,685 43 2,566 101 660 5,407 35 973 337 145 1,124 187 219 536 69 128
zma-miR393a-3p AUCAGUGCAAUCCCUUUGGAAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR393a-5p UCCAAAGGGAUCGCAUUGAUCU 22 103 6 41 1    2 1 41 6 14 0 0 19 11 6 0 1 1 1 0 0
zma-miR393b-3p AUCAAUGCGAUCCUUUUGGAGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR393b-5p UCCAAAGGGAUCGCAUUGAUCC 22 6 0 3 1    2 1 0 0 0 3 0 0 0 0 0 0 0 0 0 0
zma-miR393c-3p GUCAGUGCAAUCCCUUUGGAAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR393c-5p UCCAAAGGGAUCGCAUUGAUCU 22 103 6 41 1    2 1 41 6 14 0 0 19 11 6 0 1 1 1 0 0
zma-miR394a-3p AGGUGGGCAUACUGCCAAUG 20 49 3 34 1    34 4 1 0 1 7 0 0 0 0 1 0 1 0 0 0
zma-miR394a-5p UUGGCAUUCUGUCCACCUCC 20 84,695 5,293 35,942 1    35,942 25,633 1,512 43 146 20,033 611 20 1 3 279 178 255 28 4 7
zma-miR394b-3p AGGUGGGCAUACUGCCAAUG 20 49 3 34 1    34 4 1 0 1 7 0 0 0 0 1 0 1 0 0 0
zma-miR394b-5p UUGGCAUUCUGUCCACCUCC 20 84,695 5,293 35,942 1    35,942 25,633 1,512 43 146 20,033 611 20 1 3 279 178 255 28 4 7
zma-miR395a-3p GUGAAGUGUUUGGGGGAACUC 21 4 0 3 1    0 0 0 0 0 3 0 0 0 0 0 0 0 0 1 0
zma-miR395a-5p GUUCUCCUCAAACCACUUCAGUU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395b-3p GUGAAGUGUUUGGGGGAACUC 21 4 0 3 1    0 0 0 0 0 3 0 0 0 0 0 0 0 0 1 0
zma-miR395b-5p GUUCCCUACAAGCACUUCACAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395c-3p GUGAAGUGUUUGGAGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395c-5p GUUCCCUGCAAACACUUCACCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395d-3p GUGAAGUGUUUGGGGGAACUC 21 4 0 3 1    0 0 0 0 0 3 0 0 0 0 0 0 0 0 1 0
zma-miR395d-5p GUUCUAUGCAAGCACUUCACGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395e-3p GUGAAGUGUUUGGGGGAACUC 21 4 0 3 1    0 0 0 0 0 3 0 0 0 0 0 0 0 0 1 0
zma-miR395e-5p GUUCCCUUCAAGCACUUCACAU 22 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395f-3p GUGAAGUGUUUGGGGGAACUC 21 4 0 3 1    0 0 0 0 0 3 0 0 0 0 0 0 0 0 1 0
zma-miR395f-5p GUUACCUACAAGCACGUCUCGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395g-3p GUGAAGUGUUUGGGGGAACUC 21 4 0 3 1    0 0 0 0 0 3 0 0 0 0 0 0 0 0 1 0
zma-miR395g-5p GUUCUAUGCAAGCACUUCACGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395h-3p GUGAAGUGUUUGGGGGAACUC 21 4 0 3 1    0 0 0 0 0 3 0 0 0 0 0 0 0 0 1 0
zma-miR395h-5p GUUCCCUUCAAGCACUUCACAU 22 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395i-3p GUGAAGUGUUUGGGGGAACUC 21 4 0 3 1    0 0 0 0 0 3 0 0 0 0 0 0 0 0 1 0
zma-miR395i-5p GUUCCCUACAAGCACUUCACGA 22 3 0 1 1    0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 1
zma-miR395j-3p GUGAAGUGUUUGGGGGAACUC 21 4 0 3 1    0 0 0 0 0 3 0 0 0 0 0 0 0 0 1 0
zma-miR395j-5p GUUCCCUUCAAGCACUUCACAU 22 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395k-3p GUGAAGUGUUUGAGGAAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395k-5p GUUUCCUUCAAGCACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395l-3p GUGAAGUGUUUGGAGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395l-5p GUUCCUUCCAAACACUUCACCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395m-3p GUGAAGUGUUUGGAGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395m-5p GUUCCUUUCAAACACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395n-3p GUGAAGUGUUUGGGGGAACUC 21 4 0 3 1    0 0 0 0 0 3 0 0 0 0 0 0 0 0 1 0
zma-miR395n-5p GUUCUCUACAAGCACUUCACGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395o-3p GUGAAGUGUUUGGGUGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395o-5p GUUCUCUUCAAGCACUUCACGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395p-3p GUGAAGUGUUUGGGGGAACUC 21 4 0 3 1    0 0 0 0 0 3 0 0 0 0 0 0 0 0 1 0
zma-miR395p-5p GUUCCCUUCAAGCACUUCACAU 22 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR396a-3p GUUCAAUAAAGCUGUGGGAAA 21 196 12 58 1    3 0 33 24 58 0 1 17 16 7 19 5 5 4 1 3
zma-miR396a-5p UUCCACAGCUUUCUUGAACUG 21 6,317 395 2,018 10    523 452 2,018 157 497 104 405 600 517 148 536 21 20 294 10 15
zma-miR396b-3p GUUCAAUAAAGCUGUGGGAAA 21 196 12 58 1    3 0 33 24 58 0 1 17 16 7 19 5 5 4 1 3
zma-miR396b-5p UUCCACAGCUUUCUUGAACUG 21 6,317 395 2,018 10    523 452 2,018 157 497 104 405 600 517 148 536 21 20 294 10 15
zma-miR396c UUCCACAGGCUUUCUUGAACUG 22 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR396d UUCCACAGGCUUUCUUGAACUG 22 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR396e-3p GGUCAAGAAAGCCGUGGGAAG 21 3 0 3 3    3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR396e-5p UUCCACAGCUUUCUUGAACUU 21 5,276 330 1,728 2    10 4 774 210 870 0 3 1,728 1,073 547 11 4 11 14 2 15
zma-miR396f-3p GGUCAAGAAAGCUGUGGGAAG 21 377 24 220 1    220 2 17 3 16 72 3 20 18 3 2 0 0 1 0 0
zma-miR396f-5p UUCCACAGCUUUCUUGAACUU 21 5,276 330 1,728 2    10 4 774 210 870 0 3 1,728 1,073 547 11 4 11 14 2 15
zma-miR396g-3p GUUCAAGAAAGCUGUGGAAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR396g-5p UCCCACAGCUUUAUUGAACUG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0
zma-miR396h UCCCACAGCUUUAUUGAACUG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0
zma-miR397a-3p UAGCCGUUAGCGCUCAUUAACU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR397a-5p UCAUUGAGCGCAGCGUUGAUG 21 281 18 57 1    57 1 27 18 47 13 5 9 1 4 1 35 32 0 12 19
zma-miR397b-3p CCAGCGCUGCACUCAAUUACG 21 21 1 7 1    3 0 5 0 7 0 0 2 0 0 0 2 1 0 0 1
zma-miR397b-5p UCAUUGAGCGCAGCGUUGAUG 21 281 18 57 1    57 1 27 18 47 13 5 9 1 4 1 35 32 0 12 19
zma-miR398a-3p UGUGUUCUCAGGUCGCCCCCG 21 1,594 100 305 1    66 14 216 103 305 280 11 51 9 18 2 241 249 1 9 19
zma-miR398a-5p GGGGCGAACUGAGAACACAUG 21 309 19 207 2    13 0 207 5 25 3 0 30 4 2 0 9 6 0 2 3
zma-miR398b-3p UGUGUUCUCAGGUCGCCCCCG 21 1,594 100 305 1    66 14 216 103 305 280 11 51 9 18 2 241 249 1 9 19
zma-miR398b-5p GGGGCGGACUGGGAACACAUG 21 184 12 55 1    2 0 55 11 30 3 0 0 0 1 0 31 49 1 0 1
zma-miR399a-3p UGCCAAAGGAGAAUUGCCCUG 21 57 4 15 1    15 0 12 3 5 0 0 5 0 0 13 1 1 1 0 1
zma-miR399a-5p GUGCGGUUCUCCUCUGGCACG 21 5 0 4 1    0 4 1 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR399b-3p UGCCAAAGGAGAGCUGUCCUG 21 38 2 29 1    5 0 2 0 0 0 0 1 0 0 29 0 1 0 0 0
zma-miR399b-5p GUGCAGCUCUCCUCUGGCAUG 21 15 1 6 1    6 5 0 0 0 3 0 0 0 0 1 0 0 0 0 0
zma-miR399c-3p UGCCAAAGGAGAAUUGCCCUG 21 57 4 15 1    15 0 12 3 5 0 0 5 0 0 13 1 1 1 0 1
zma-miR399c-5p GGGUACGUCUCCUUUGGCACA 21 13 1 6 1    0 3 2 0 0 0 0 0 0 0 6 0 1 1 0 0
zma-miR399d-3p UGCCAAAGGAGAGCUGCCCUG 21 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR399d-5p GUGUGGCUCUCCUCUGGCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR399e-3p UGCCAAAGGAGAGUUGCCCUG 21 746 47 345 1    6 0 345 27 65 16 0 47 14 14 169 3 6 30 3 1
zma-miR399e-5p GGGCUUCUCUUUCUUGGCAGG 21 18 1 11 1    0 0 1 2 0 0 0 0 0 0 11 1 0 3 0 0
zma-miR399f-3p UGCCAAAGGAAAUUUGCCCCG 21 27 2 13 1    0 0 8 0 4 0 0 0 1 0 13 0 0 1 0 0
zma-miR399f-5p GGGCAACUUCUCCUUUGGCAGA 22 10 1 5 2    5 0 3 0 0 0 0 0 0 0 2 0 0 0 0 0
zma-miR399g-3p UGCCAAAGGGGAUUUGCCCGG 21 34 2 31 1    31 1 1 0 0 0 0 0 0 0 1 0 0 0 0 0
zma-miR399g-5p GGGCAACCCCCCGUUGGCAGG 21 2 0 1 1    0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0
zma-miR399h-3p UGCCAAAGGAGAAUUGCCCUG 21 57 4 15 1    15 0 12 3 5 0 0 5 0 0 13 1 1 1 0 1
zma-miR399h-5p GUGCAGUUCUCCUCUGGCACG 21 29 2 19 3    3 19 0 0 0 7 0 0 0 0 0 0 0 0 0 0
zma-miR399i-3p UGCCAAAGGAGAGUUGCCCUG 21 746 47 345 1    6 0 345 27 65 16 0 47 14 14 169 3 6 30 3 1
zma-miR399i-5p GUGCGGCUCUCCUCUGGCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR399j-3p UGCCAAAGGAGAGUUGCCCUG 21 746 47 345 1    6 0 345 27 65 16 0 47 14 14 169 3 6 30 3 1
zma-miR399j-5p AGGCAGCUCUCCUCUGGCAGG 21 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR408a CUGCACUGCCUCUUCCCUGGC 21 8,045 503 2,332 1    2,332 298 1,452 423 1,270 1,728 26 48 15 12 9 250 174 1 1 6
zma-miR408b-3p CUGCACUGCCUCUUCCCUGGC 21 8,045 503 2,332 1    2,332 298 1,452 423 1,270 1,728 26 48 15 12 9 250 174 1 1 6
zma-miR408b-5p CAGGGACGAGGCAGAGCAUGG 21 258 16 111 1    42 1 57 4 14 111 0 1 0 0 1 10 16 0 0 1
zma-miR444a UGCAGUUGUUGUCUCAAGCUU 21 8,215 513 2,782 22    2,782 1,432 1,428 86 217 926 498 337 79 22 137 84 91 25 24 47
zma-miR444b UGCAGUUGUUGUCUCAAGCUU 21 8,215 513 2,782 22    2,782 1,432 1,428 86 217 926 498 337 79 22 137 84 91 25 24 47
zma-miR482-3p UCUUCCUUGUUCCUCCCAUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR482-5p UGGGAGAUGAAGGAGCCUU 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR528a-3p CCUGUGCCUGCCUCUUCCAUU 21 805 50 396 1    0 0 396 23 93 7 1 43 6 7 2 103 74 0 19 31
zma-miR528a-5p UGGAAGGGGCAUGCAGAGGAG 21 2,647 165 545 3    410 3 292 68 252 545 18 199 45 26 41 377 259 4 37 71
zma-miR528b-3p CCUGUGCCUGCCUCUUCCAUU 21 805 50 396 1    0 0 396 23 93 7 1 43 6 7 2 103 74 0 19 31
zma-miR528b-5p UGGAAGGGGCAUGCAGAGGAG 21 2,647 165 545 3    410 3 292 68 252 545 18 199 45 26 41 377 259 4 37 71
zma-miR529-3p GCUGUACCCUCUCUCUUCUUC 21 11,270 704 6,734 2    0 0 69 2 8 0 0 21 22 4 4,093 109 97 6,734 48 63
zma-miR529-5p AGAAGAGAGAGAGUACAGCCU 21 369,469 23,092 193,488 5    5 0 6,882 177 416 36 0 2,331 2,752 123 193,488 37,893 16,788 89,025 8,171 11,382
zma-miR827-3p UUAGAUGACCAUCAGCAAACA 21 13,480 843 7,773 2    259 6 7,773 290 415 55 2 1,745 177 188 394 290 698 603 221 364
zma-miR827-5p UUUGUUGGUGGUCAUUUAACC 21 41 3 13 1    2 0 13 3 4 0 0 1 1 0 6 2 3 4 1 1