Maize B73 small RNA miRNA Abundances

The data below are based on the microRNAs listed in the miRBase registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  0.2Fertile_r10.4Fertile_r10.7Fertile_r11.0Fertile_r11.5Fertile_r12.0Fertile_r12.5Fertile_r13.0Fertile_r14.0Fertile_r15.0Fertile_r1PLN_Fertile_r10.2Fertile_r20.4Fertile_r20.7Fertile_r21.0Fertile_r21.5Fertile_r22.0Fertile_r22.5Fertile_r23.0Fertile_r24.0Fertile_r25.0Fertile_r2PLN_Fertile_r20.4Fertile_r30.7Fertile_r31.0Fertile_r31.5Fertile_r32.0Fertile_r32.5Fertile_r33.0Fertile_r34.0Fertile_r35.0Fertile_r3PollenFertile_r30.4msca1_r10.7msca1_r11.0msca1_r11.5msca1_r12.0_msca1_r10.4msca1_r20.7msca1_r21.0msca1_r21.5msca1_r22.0msca1_r20.4ocl4_r10.7ocl4_r11.0ocl4_r11.5ocl4_r12.0ocl4_r10.4ocl4_r20.7ocl4_r21.0ocl4_r21.5ocl4_r22.0ocl4_r20.4mac1_r10.7mac1_r11.0mac1_r11.5mac1_r12.0mac1_r10.4mac1_r20.7mac1_r21.0mac1_r21.5mac1_r22.0mac1_r20.4ms23_r10.7ms23_r10.7 ms23_r21.0 ms23_r11.0 ms23_r21.5 ms23_r11.5 ms23_r22.0 ms23_r12.0 ms23_r20.4am1_489_r10.7am1_489_r11.0am1_489_r11.5am1_489_r11.5am1_489_r21.0am1_p_r11.0am1_p_r21.0am1_p_r31.5am1_p_r11.5am1_p_r21.5am1_p_r31.5WT_489_r11.5WT_489_r21.5WT_489_r31.25am1_p_r11.25am1_p_r21.25am1_p_r31.25WT_p_r11.25WT_p_r21.25WT_p_r31.25am1_489_r11.25am1_489_r21.25WT_489_r11.25WT_489_r21.25WT_489_r3
zma-miR11969-3p UUAUACCCAUCUCUCACCUUGCAA 24 46 0 6 1    0 3 0 1 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 6 4 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 1 1 0 1 3 2 0 0 0 0 0 0 0 0 0 0 0 0 3 2 3 0 2 1 2 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR11969-5p GCAAGGUCAGAGAAGGAUAUAAUC 24 10 0 2 1    0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR11970-3p UGGUUUGGUUGCACGUUUGCA 21 251 3 16 1    3 2 0 7 1 5 4 1 1 3 0 9 0 0 1 0 0 1 0 0 0 0 2 3 3 4 5 8 4 2 1 0 0 0 0 0 0 0 3 0 0 0 3 4 4 14 4 6 4 6 5 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 3 16 5 5 5 12 6 3 5 5 2 7 6 5 3 2 2 1 6 3 6 5 5 6
zma-miR11970-5p CAAGCGUGCAAGCAAACCAUU 21 13 0 1 1    0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0
zma-miR1432-3p GGGUGUCAUCUCGCCUGAAGCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR1432-5p CUCAGGAGAGAUGACACCGAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR156a-3p GCUCACUUCUCUCUCUGUCAGU 22 60 1 14 1    0 0 0 0 0 0 1 1 6 1 0 0 0 0 0 0 0 1 1 1 1 0 0 0 0 1 1 0 3 14 2 0 0 0 0 0 7 0 0 1 9 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR156a-5p UGACAGAAGAGAGUGAGCAC 20 2,432 25 127 1    0 9 5 1 4 6 5 35 45 108 112 2 29 20 16 10 3 19 64 114 87 89 9 16 25 19 8 10 32 71 107 42 30 22 8 6 24 94 46 65 127 81 13 4 14 3 3 37 20 23 17 6 1 8 6 6 4 1 8 37 24 62 8 5 12 12 7 19 11 7 9 1 1 1 2 14 4 10 5 4 6 3 4 3 5 80 19 53 30 40 20 29 31 10 26 19
zma-miR156b-3p GCUCACCCUCUAUCUGUCAGU 21 10 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0
zma-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 2,432 25 127 1    0 9 5 1 4 6 5 35 45 108 112 2 29 20 16 10 3 19 64 114 87 89 9 16 25 19 8 10 32 71 107 42 30 22 8 6 24 94 46 65 127 81 13 4 14 3 3 37 20 23 17 6 1 8 6 6 4 1 8 37 24 62 8 5 12 12 7 19 11 7 9 1 1 1 2 14 4 10 5 4 6 3 4 3 5 80 19 53 30 40 20 29 31 10 26 19
zma-miR156c UGACAGAAGAGAGUGAGCAC 20 2,432 25 127 1    0 9 5 1 4 6 5 35 45 108 112 2 29 20 16 10 3 19 64 114 87 89 9 16 25 19 8 10 32 71 107 42 30 22 8 6 24 94 46 65 127 81 13 4 14 3 3 37 20 23 17 6 1 8 6 6 4 1 8 37 24 62 8 5 12 12 7 19 11 7 9 1 1 1 2 14 4 10 5 4 6 3 4 3 5 80 19 53 30 40 20 29 31 10 26 19
zma-miR156d-3p GCUCACUUCUCUUUCUGUCAGC 22 99 1 6 1    0 1 1 1 0 1 1 1 1 0 0 1 0 0 0 1 1 0 0 1 1 0 1 1 6 3 2 0 0 2 1 0 0 1 0 0 1 2 0 1 5 4 0 1 0 1 0 0 1 1 1 1 1 0 0 1 0 1 1 2 1 2 1 0 0 0 0 1 0 0 1 0 0 1 4 2 1 5 2 1 1 1 4 5 3 1 0 1 1 1 0 1 2 0 1 1
zma-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 2,432 25 127 1    0 9 5 1 4 6 5 35 45 108 112 2 29 20 16 10 3 19 64 114 87 89 9 16 25 19 8 10 32 71 107 42 30 22 8 6 24 94 46 65 127 81 13 4 14 3 3 37 20 23 17 6 1 8 6 6 4 1 8 37 24 62 8 5 12 12 7 19 11 7 9 1 1 1 2 14 4 10 5 4 6 3 4 3 5 80 19 53 30 40 20 29 31 10 26 19
zma-miR156e-3p GCUCACUGCUCUCUCUGUCAUC 22 26 0 4 1    0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 1 0 0 1 1 1 0 0 0 1 0 3 0 0 4 4 3 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR156e-5p UGACAGAAGAGAGUGAGCAC 20 2,432 25 127 1    0 9 5 1 4 6 5 35 45 108 112 2 29 20 16 10 3 19 64 114 87 89 9 16 25 19 8 10 32 71 107 42 30 22 8 6 24 94 46 65 127 81 13 4 14 3 3 37 20 23 17 6 1 8 6 6 4 1 8 37 24 62 8 5 12 12 7 19 11 7 9 1 1 1 2 14 4 10 5 4 6 3 4 3 5 80 19 53 30 40 20 29 31 10 26 19
zma-miR156f-3p GCUCACUUCUCUUUCUGUCAGC 22 99 1 6 1    0 1 1 1 0 1 1 1 1 0 0 1 0 0 0 1 1 0 0 1 1 0 1 1 6 3 2 0 0 2 1 0 0 1 0 0 1 2 0 1 5 4 0 1 0 1 0 0 1 1 1 1 1 0 0 1 0 1 1 2 1 2 1 0 0 0 0 1 0 0 1 0 0 1 4 2 1 5 2 1 1 1 4 5 3 1 0 1 1 1 0 1 2 0 1 1
zma-miR156f-5p UGACAGAAGAGAGUGAGCAC 20 2,432 25 127 1    0 9 5 1 4 6 5 35 45 108 112 2 29 20 16 10 3 19 64 114 87 89 9 16 25 19 8 10 32 71 107 42 30 22 8 6 24 94 46 65 127 81 13 4 14 3 3 37 20 23 17 6 1 8 6 6 4 1 8 37 24 62 8 5 12 12 7 19 11 7 9 1 1 1 2 14 4 10 5 4 6 3 4 3 5 80 19 53 30 40 20 29 31 10 26 19
zma-miR156g-3p GCUCACUUCUCUUUCUGUCAGC 22 99 1 6 1    0 1 1 1 0 1 1 1 1 0 0 1 0 0 0 1 1 0 0 1 1 0 1 1 6 3 2 0 0 2 1 0 0 1 0 0 1 2 0 1 5 4 0 1 0 1 0 0 1 1 1 1 1 0 0 1 0 1 1 2 1 2 1 0 0 0 0 1 0 0 1 0 0 1 4 2 1 5 2 1 1 1 4 5 3 1 0 1 1 1 0 1 2 0 1 1
zma-miR156g-5p UGACAGAAGAGAGUGAGCAC 20 2,432 25 127 1    0 9 5 1 4 6 5 35 45 108 112 2 29 20 16 10 3 19 64 114 87 89 9 16 25 19 8 10 32 71 107 42 30 22 8 6 24 94 46 65 127 81 13 4 14 3 3 37 20 23 17 6 1 8 6 6 4 1 8 37 24 62 8 5 12 12 7 19 11 7 9 1 1 1 2 14 4 10 5 4 6 3 4 3 5 80 19 53 30 40 20 29 31 10 26 19
zma-miR156h-3p GCUCACUGCUCUUUCUGUCAUC 22 31 0 3 1    0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 1 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 1 1 0 0 0 1 1 2 0 0 0 1 0 1 0 0 0 0 0 0 1 1 1 3 0 1 0 2 0 0 0 0 0 1 1 1 1 0 0 0 1 1
zma-miR156h-5p UGACAGAAGAGAGUGAGCAC 20 2,432 25 127 1    0 9 5 1 4 6 5 35 45 108 112 2 29 20 16 10 3 19 64 114 87 89 9 16 25 19 8 10 32 71 107 42 30 22 8 6 24 94 46 65 127 81 13 4 14 3 3 37 20 23 17 6 1 8 6 6 4 1 8 37 24 62 8 5 12 12 7 19 11 7 9 1 1 1 2 14 4 10 5 4 6 3 4 3 5 80 19 53 30 40 20 29 31 10 26 19
zma-miR156i-3p GCUCACUGCUCUAUCUGUCAUC 22 48 1 7 1    0 0 0 0 0 0 1 0 1 0 7 0 0 0 0 1 0 0 1 0 0 5 0 0 0 0 0 0 0 2 1 3 0 4 0 0 7 0 0 2 7 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR156i-5p UGACAGAAGAGAGUGAGCAC 20 2,432 25 127 1    0 9 5 1 4 6 5 35 45 108 112 2 29 20 16 10 3 19 64 114 87 89 9 16 25 19 8 10 32 71 107 42 30 22 8 6 24 94 46 65 127 81 13 4 14 3 3 37 20 23 17 6 1 8 6 6 4 1 8 37 24 62 8 5 12 12 7 19 11 7 9 1 1 1 2 14 4 10 5 4 6 3 4 3 5 80 19 53 30 40 20 29 31 10 26 19
zma-miR156j-3p UGCUCUCUGCUCUCACUGUCAUC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR156j-5p UGACAGAAGAGAGAGAGCACA 21 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR156k-3p GCUCGCUUCUCUUUCUGUCAGC 22 46 0 5 1    1 0 0 1 1 1 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 1 2 0 1 1 1 1 1 0 0 0 0 0 1 0 0 4 3 5 0 0 0 0 0 0 0 0 0 2 2 0 1 0 0 1 0 1 1 1 0 0 0 0 0 1 0 0 0 0 0 0 1 0 1 0 0 0 0 0 1 0 1 0 0 0 1 1 0 1 0 0 1 0
zma-miR156k-5p UGACAGAAGAGAGCGAGCAC 20 251 3 18 1    0 2 1 1 1 1 2 3 2 2 0 0 1 1 4 0 2 4 5 4 1 0 2 5 5 3 2 6 3 5 5 0 3 0 1 1 4 8 2 6 7 9 2 0 2 2 1 5 3 4 2 2 1 2 1 2 1 1 2 3 4 18 3 2 3 2 2 4 2 5 2 0 0 0 0 2 1 4 3 1 2 1 2 2 1 3 3 4 4 4 1 7 2 1 3 3
zma-miR156l-3p GCUCACUGCUCUAUCUGUCACC 22 85 1 6 1    0 0 0 0 1 1 1 0 0 0 1 0 1 5 0 0 0 2 0 1 0 0 2 0 5 2 0 1 1 2 1 0 0 0 0 1 1 2 1 4 6 6 2 0 1 1 1 2 4 4 2 2 0 0 0 1 0 0 1 0 1 1 0 0 0 1 0 0 1 0 0 0 0 0 1 0 0 0 0 1 1 0 0 1 1 3 1 1 1 1 0 0 0 0 0 0
zma-miR156l-5p UGACAGAAGAGAGUGAGCAC 20 2,432 25 127 1    0 9 5 1 4 6 5 35 45 108 112 2 29 20 16 10 3 19 64 114 87 89 9 16 25 19 8 10 32 71 107 42 30 22 8 6 24 94 46 65 127 81 13 4 14 3 3 37 20 23 17 6 1 8 6 6 4 1 8 37 24 62 8 5 12 12 7 19 11 7 9 1 1 1 2 14 4 10 5 4 6 3 4 3 5 80 19 53 30 40 20 29 31 10 26 19
zma-miR159a-3p UUUGGAUUGAAGGGAGCUCUG 21 90,330 941 11,051 11    4,610 688 132 60 1,229 521 118 137 55 33 212 4,304 1,706 902 583 3,974 9,011 11,051 4,217 3,763 287 913 184 297 1,889 1,424 764 737 266 398 193 188 2,127 2,025 711 1,203 98 907 291 270 606 1,168 69 29 73 73 64 514 234 264 381 317 37 82 53 45 18 94 198 215 127 83 132 48 43 56 19 38 36 38 46 531 175 192 1,838 317 547 947 465 395 985 373 7,713 2,861 4,984 38 12 28 11 44 55 24 32 25 17 43
zma-miR159a-5p GAGCUCCUAUCAUUCCAAUGA 21 151 2 25 1    12 0 0 0 0 0 1 0 0 1 0 2 0 0 0 0 0 0 0 0 0 0 1 0 2 4 0 0 0 2 0 0 0 0 0 0 1 3 1 19 25 4 1 2 1 0 1 4 1 2 0 0 4 0 0 1 0 7 4 7 1 3 1 0 0 1 0 0 0 0 0 0 1 0 1 1 1 1 1 0 1 0 6 2 7 3 0 0 1 3 1 0 0 1 0 1
zma-miR159b-3p UUUGGAUUGAAGGGAGCUCUG 21 90,330 941 11,051 11    4,610 688 132 60 1,229 521 118 137 55 33 212 4,304 1,706 902 583 3,974 9,011 11,051 4,217 3,763 287 913 184 297 1,889 1,424 764 737 266 398 193 188 2,127 2,025 711 1,203 98 907 291 270 606 1,168 69 29 73 73 64 514 234 264 381 317 37 82 53 45 18 94 198 215 127 83 132 48 43 56 19 38 36 38 46 531 175 192 1,838 317 547 947 465 395 985 373 7,713 2,861 4,984 38 12 28 11 44 55 24 32 25 17 43
zma-miR159b-5p GUGCUCCCUUCAAACCAAUAA 21 1,717 18 281 1    0 0 0 5 3 88 27 2 5 0 1 0 0 0 0 1 1 1 0 0 0 0 0 0 61 281 119 115 20 24 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 68 18 1 0 0 211 114 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 90 5 0 0 0 7 70 16 97 66 196 0 0 0 0 0 0 0 1 0 0 0
zma-miR159c-3p CUUGGAUUGAAGGGAGCUCCU 21 5 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159c-5p GAGCUCCCUUCGAUCCAAUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159d-3p CUUGGAUUGAAGGGAGCUCCU 21 5 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159d-5p GAGCUCCCUUCGAUCCAAUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159e-3p AUUGGUUUGAAGGGAGCUCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159e-5p CAGCUCCUGCAGCAUCUGUUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159f-3p UUUGGAUUGAAGGGAGCUCUG 21 90,330 941 11,051 11    4,610 688 132 60 1,229 521 118 137 55 33 212 4,304 1,706 902 583 3,974 9,011 11,051 4,217 3,763 287 913 184 297 1,889 1,424 764 737 266 398 193 188 2,127 2,025 711 1,203 98 907 291 270 606 1,168 69 29 73 73 64 514 234 264 381 317 37 82 53 45 18 94 198 215 127 83 132 48 43 56 19 38 36 38 46 531 175 192 1,838 317 547 947 465 395 985 373 7,713 2,861 4,984 38 12 28 11 44 55 24 32 25 17 43
zma-miR159f-5p GAGCUCCUCUCAUUCCAAUGA 21 47 0 22 1    22 1 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 3 0 1 1 0 6 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 1 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1
zma-miR159g-3p UUUGGAGUGAAGGGAGUUCUG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159g-5p GUGCUCCCUUCACACCAAUAA 21 1,064 11 181 1    0 0 0 4 1 63 19 4 1 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 33 181 84 80 18 14 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 74 11 0 0 0 158 104 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 75 1 0 0 0 9 15 5 27 27 53 0 0 0 0 0 0 0 0 0 0 0
zma-miR159h-3p UUUGGAGUGAAGGGAGCUCUG 21 2,162 23 322 1    0 0 1 3 101 44 10 3 1 3 8 2 1 0 6 117 322 321 106 65 3 12 0 2 46 97 47 52 16 17 11 7 5 5 1 3 0 0 0 0 0 0 1 0 0 11 7 1 0 1 48 33 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 103 7 1 1 1 29 44 13 177 112 129 0 0 0 0 0 0 0 0 0 0 1
zma-miR159h-5p GUGCUCCCUUCACACCAAUAA 21 1,064 11 181 1    0 0 0 4 1 63 19 4 1 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 33 181 84 80 18 14 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 74 11 0 0 0 158 104 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 75 1 0 0 0 9 15 5 27 27 53 0 0 0 0 0 0 0 0 0 0 0
zma-miR159i-3p UUUGGAGUGAAGGGAGCUCUG 21 2,162 23 322 1    0 0 1 3 101 44 10 3 1 3 8 2 1 0 6 117 322 321 106 65 3 12 0 2 46 97 47 52 16 17 11 7 5 5 1 3 0 0 0 0 0 0 1 0 0 11 7 1 0 1 48 33 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 103 7 1 1 1 29 44 13 177 112 129 0 0 0 0 0 0 0 0 0 0 1
zma-miR159i-5p GUGCUCCCUUCACACCAAUAA 21 1,064 11 181 1    0 0 0 4 1 63 19 4 1 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 33 181 84 80 18 14 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 74 11 0 0 0 158 104 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 75 1 0 0 0 9 15 5 27 27 53 0 0 0 0 0 0 0 0 0 0 0
zma-miR159j-3p UUUGGAUUGAAGGGAGCUCUG 21 90,330 941 11,051 11    4,610 688 132 60 1,229 521 118 137 55 33 212 4,304 1,706 902 583 3,974 9,011 11,051 4,217 3,763 287 913 184 297 1,889 1,424 764 737 266 398 193 188 2,127 2,025 711 1,203 98 907 291 270 606 1,168 69 29 73 73 64 514 234 264 381 317 37 82 53 45 18 94 198 215 127 83 132 48 43 56 19 38 36 38 46 531 175 192 1,838 317 547 947 465 395 985 373 7,713 2,861 4,984 38 12 28 11 44 55 24 32 25 17 43
zma-miR159j-5p GUGCUCCCUUCAAACCAAUAA 21 1,717 18 281 1    0 0 0 5 3 88 27 2 5 0 1 0 0 0 0 1 1 1 0 0 0 0 0 0 61 281 119 115 20 24 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 68 18 1 0 0 211 114 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 90 5 0 0 0 7 70 16 97 66 196 0 0 0 0 0 0 0 1 0 0 0
zma-miR159k-3p UUUGGAUUGAAGGGAGCUCUG 21 90,330 941 11,051 11    4,610 688 132 60 1,229 521 118 137 55 33 212 4,304 1,706 902 583 3,974 9,011 11,051 4,217 3,763 287 913 184 297 1,889 1,424 764 737 266 398 193 188 2,127 2,025 711 1,203 98 907 291 270 606 1,168 69 29 73 73 64 514 234 264 381 317 37 82 53 45 18 94 198 215 127 83 132 48 43 56 19 38 36 38 46 531 175 192 1,838 317 547 947 465 395 985 373 7,713 2,861 4,984 38 12 28 11 44 55 24 32 25 17 43
zma-miR159k-5p GUGCUCCCUUCAAACCAAUAA 21 1,717 18 281 1    0 0 0 5 3 88 27 2 5 0 1 0 0 0 0 1 1 1 0 0 0 0 0 0 61 281 119 115 20 24 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 68 18 1 0 0 211 114 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 90 5 0 0 0 7 70 16 97 66 196 0 0 0 0 0 0 0 1 0 0 0
zma-miR160a-3p GCGUGCAAGGGGCCAAGCAUG 21 21 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 1 1 2 1 1 0 0 0 0 0 0 0 1 1 0 1 0 0 0 0 0 0 1 1 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 1 1 0 0 1 0 0 1 0 1 0 0 0 1 0 0 0 0 0 0
zma-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 8,115 85 414 1    387 107 10 6 4 14 5 5 1 5 0 217 12 10 1 4 0 1 1 0 2 0 122 110 164 95 13 7 6 12 0 1 16 200 125 128 64 414 291 206 328 384 86 5 19 64 17 149 175 104 33 12 149 98 80 106 61 238 72 148 47 72 172 83 73 124 54 62 62 76 88 61 52 78 65 103 221 176 125 64 66 85 46 45 69 130 82 108 29 71 57 78 78 83 89 47
zma-miR160b-3p GCGUGCAAGGAGCCAAGCAUG 21 102 1 15 1    0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 1 1 0 0 0 0 0 0 0 1 1 0 1 5 2 15 12 3 3 0 0 0 1 5 1 1 1 1 4 0 1 1 0 1 2 2 1 1 1 0 0 1 0 0 1 0 0 0 1 0 0 0 1 0 1 0 1 1 0 0 1 7 1 2 2 1 1 0 1 1 3 1
zma-miR160b-5p UGCCUGGCUCCCUGUAUGCCA 21 8,115 85 414 1    387 107 10 6 4 14 5 5 1 5 0 217 12 10 1 4 0 1 1 0 2 0 122 110 164 95 13 7 6 12 0 1 16 200 125 128 64 414 291 206 328 384 86 5 19 64 17 149 175 104 33 12 149 98 80 106 61 238 72 148 47 72 172 83 73 124 54 62 62 76 88 61 52 78 65 103 221 176 125 64 66 85 46 45 69 130 82 108 29 71 57 78 78 83 89 47
zma-miR160c-3p GCGUGCAUGGUGCCAAGCAUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 8,115 85 414 1    387 107 10 6 4 14 5 5 1 5 0 217 12 10 1 4 0 1 1 0 2 0 122 110 164 95 13 7 6 12 0 1 16 200 125 128 64 414 291 206 328 384 86 5 19 64 17 149 175 104 33 12 149 98 80 106 61 238 72 148 47 72 172 83 73 124 54 62 62 76 88 61 52 78 65 103 221 176 125 64 66 85 46 45 69 130 82 108 29 71 57 78 78 83 89 47
zma-miR160d-3p GCGUGCGUGGAGCCAAGCAUG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
zma-miR160d-5p UGCCUGGCUCCCUGUAUGCCA 21 8,115 85 414 1    387 107 10 6 4 14 5 5 1 5 0 217 12 10 1 4 0 1 1 0 2 0 122 110 164 95 13 7 6 12 0 1 16 200 125 128 64 414 291 206 328 384 86 5 19 64 17 149 175 104 33 12 149 98 80 106 61 238 72 148 47 72 172 83 73 124 54 62 62 76 88 61 52 78 65 103 221 176 125 64 66 85 46 45 69 130 82 108 29 71 57 78 78 83 89 47
zma-miR160e UGCCUGGCUCCCUGUAUGCCA 21 8,115 85 414 1    387 107 10 6 4 14 5 5 1 5 0 217 12 10 1 4 0 1 1 0 2 0 122 110 164 95 13 7 6 12 0 1 16 200 125 128 64 414 291 206 328 384 86 5 19 64 17 149 175 104 33 12 149 98 80 106 61 238 72 148 47 72 172 83 73 124 54 62 62 76 88 61 52 78 65 103 221 176 125 64 66 85 46 45 69 130 82 108 29 71 57 78 78 83 89 47
zma-miR160f-3p GCGUGCGAGGUGCCAGGCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR160f-5p UGCCUGGCUCCCUGUAUGCCG 21 62 1 6 1    2 1 0 0 0 0 0 1 0 1 0 0 1 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 1 0 1 1 1 0 0 1 0 1 1 0 0 0 0 1 0 0 0 1 1 1 1 0 0 0 0 0 0 1 0 0 1 1 1 0 1 1 1 1 0 2 1 6 0 4 1 1 2 1 0 1 2 1 1 1 1 1 1 2 3 1 0
zma-miR160g-3p GCGUGCAAGGAGCCAAGCAUG 21 102 1 15 1    0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 1 1 0 0 0 0 0 0 0 1 1 0 1 5 2 15 12 3 3 0 0 0 1 5 1 1 1 1 4 0 1 1 0 1 2 2 1 1 1 0 0 1 0 0 1 0 0 0 1 0 0 0 1 0 1 0 1 1 0 0 1 7 1 2 2 1 1 0 1 1 3 1
zma-miR160g-5p UGCCUGGCUCCCUGUAUGCCA 21 8,115 85 414 1    387 107 10 6 4 14 5 5 1 5 0 217 12 10 1 4 0 1 1 0 2 0 122 110 164 95 13 7 6 12 0 1 16 200 125 128 64 414 291 206 328 384 86 5 19 64 17 149 175 104 33 12 149 98 80 106 61 238 72 148 47 72 172 83 73 124 54 62 62 76 88 61 52 78 65 103 221 176 125 64 66 85 46 45 69 130 82 108 29 71 57 78 78 83 89 47
zma-miR162-3p UCGAUAAACCUCUGCAUCCA 20 96 1 5 1    0 5 0 0 0 1 0 0 0 0 0 4 0 0 1 0 0 1 0 0 0 0 2 1 1 1 0 2 0 0 0 0 0 4 0 0 1 4 2 1 1 2 3 0 1 1 0 3 1 2 0 0 0 3 0 1 1 0 2 5 0 1 2 2 1 1 1 1 1 1 1 1 1 1 0 1 1 1 1 1 1 1 1 0 1 2 0 1 2 1 2 1 3 1 1 1
zma-miR162-5p GGGCGCAGUGGUUUAUCGAUC 21 37 0 4 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 1 1 1 0 0 0 1 1 1 0 1 3 0 0 0 0 1 4 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 1 0 3 2 1 0 3 1 1 0 1 1 0 0 1 0 0 0 0 1 0 0
zma-miR164a-3p CACGUGUUCUCCUUCUCCAUC 21 4 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0
zma-miR164a-5p UGGAGAAGCAGGGCACGUGCA 21 7,395 77 650 1    183 25 3 20 12 62 175 197 333 85 2 86 4 10 14 18 52 161 515 342 116 19 11 12 17 40 43 177 650 439 289 46 20 74 27 213 604 66 37 113 275 254 8 7 14 72 147 14 13 13 14 12 32 38 88 193 206 28 9 25 23 50 22 15 21 12 5 17 18 27 25 3 17 33 9 13 24 22 25 14 17 14 36 42 36 19 8 11 4 8 8 6 7 1 7 2
zma-miR164b-3p AUGUGCCCAUCUUCUCCACC 20 11 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 1 1 0 0 0 1 0 0 0 1 0 1 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
zma-miR164b-5p UGGAGAAGCAGGGCACGUGCA 21 7,395 77 650 1    183 25 3 20 12 62 175 197 333 85 2 86 4 10 14 18 52 161 515 342 116 19 11 12 17 40 43 177 650 439 289 46 20 74 27 213 604 66 37 113 275 254 8 7 14 72 147 14 13 13 14 12 32 38 88 193 206 28 9 25 23 50 22 15 21 12 5 17 18 27 25 3 17 33 9 13 24 22 25 14 17 14 36 42 36 19 8 11 4 8 8 6 7 1 7 2
zma-miR164c-3p CAUGUGCCCUUCUUCUCCAUC 21 323 3 44 1    1 0 1 0 1 7 14 5 4 1 2 1 0 0 0 0 1 3 3 1 0 1 0 0 2 3 7 19 33 8 0 1 0 2 0 3 25 0 0 12 44 22 1 1 0 0 5 1 1 0 5 16 1 0 0 3 6 1 1 2 3 13 0 0 0 0 0 1 1 0 2 0 0 0 15 1 2 0 0 0 0 0 2 1 1 0 1 1 2 1 0 1 2 1 0 1
zma-miR164c-5p UGGAGAAGCAGGGCACGUGCA 21 7,395 77 650 1    183 25 3 20 12 62 175 197 333 85 2 86 4 10 14 18 52 161 515 342 116 19 11 12 17 40 43 177 650 439 289 46 20 74 27 213 604 66 37 113 275 254 8 7 14 72 147 14 13 13 14 12 32 38 88 193 206 28 9 25 23 50 22 15 21 12 5 17 18 27 25 3 17 33 9 13 24 22 25 14 17 14 36 42 36 19 8 11 4 8 8 6 7 1 7 2
zma-miR164d-3p CACGUGGUCUCCUUCUCCAU 20 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR164d-5p UGGAGAAGCAGGGCACGUGCA 21 7,395 77 650 1    183 25 3 20 12 62 175 197 333 85 2 86 4 10 14 18 52 161 515 342 116 19 11 12 17 40 43 177 650 439 289 46 20 74 27 213 604 66 37 113 275 254 8 7 14 72 147 14 13 13 14 12 32 38 88 193 206 28 9 25 23 50 22 15 21 12 5 17 18 27 25 3 17 33 9 13 24 22 25 14 17 14 36 42 36 19 8 11 4 8 8 6 7 1 7 2
zma-miR164e-3p CAUGUGUCCGCCCUCUCCACC 21 3 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0
zma-miR164e-5p UGGAGAAGCAGGACACGUGAG 21 9 0 2 1    0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0
zma-miR164f-3p CACGUGCGCUCCUUCUCCAAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR164f-5p UGGAGAAGCAGGGCACGUGCU 21 13 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 1 0 0 0 0 0 0 0 0 1 1 1 0 0 0 0 0 1 0 0 1 1 0 0 1 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR164g-3p CACGUGCUCCCCUUCUCCACC 21 5,928 62 1,045 1    489 40 4 11 5 16 12 1 0 3 0 346 20 17 6 1 1 1 0 2 6 0 24 23 21 35 11 21 0 5 4 1 152 105 9 148 91 144 25 618 1,045 346 14 5 10 12 3 26 19 17 15 9 428 12 29 46 22 603 70 78 63 55 9 7 7 18 8 7 13 4 7 2 2 7 55 3 31 13 17 18 15 16 3 2 4 55 77 27 37 33 20 27 13 5 12 9
zma-miR164g-5p UGGAGAAGCAGGGCACGUGCA 21 7,395 77 650 1    183 25 3 20 12 62 175 197 333 85 2 86 4 10 14 18 52 161 515 342 116 19 11 12 17 40 43 177 650 439 289 46 20 74 27 213 604 66 37 113 275 254 8 7 14 72 147 14 13 13 14 12 32 38 88 193 206 28 9 25 23 50 22 15 21 12 5 17 18 27 25 3 17 33 9 13 24 22 25 14 17 14 36 42 36 19 8 11 4 8 8 6 7 1 7 2
zma-miR164h-3p CAUGUGCCCUUCUUCUCCAUC 21 323 3 44 1    1 0 1 0 1 7 14 5 4 1 2 1 0 0 0 0 1 3 3 1 0 1 0 0 2 3 7 19 33 8 0 1 0 2 0 3 25 0 0 12 44 22 1 1 0 0 5 1 1 0 5 16 1 0 0 3 6 1 1 2 3 13 0 0 0 0 0 1 1 0 2 0 0 0 15 1 2 0 0 0 0 0 2 1 1 0 1 1 2 1 0 1 2 1 0 1
zma-miR164h-5p UGGAGAAGCAGGGCACGUGUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 13,145,444 136,932 535,856 1,691    35,010 73,029 17,237 4,903 12,541 12,190 7,869 15,818 15,099 17,158 6,876 25,798 52,893 60,721 18,239 19,573 7,407 8,234 11,011 10,886 7,127 3,173 215,577 278,417 67,260 96,075 15,719 17,847 13,479 16,796 10,415 1,691 72,023 136,963 84,007 63,940 30,435 360,282 136,559 272,154 249,197 209,555 57,779 30,409 69,734 20,861 6,950 336,416 354,502 269,183 77,736 18,809 83,421 94,715 55,260 49,824 65,497 61,141 150,360 252,301 247,439 376,416 133,644 87,147 77,715 139,250 73,261 102,561 82,429 64,045 64,780 28,259 18,876 16,264 63,396 346,906 224,432 352,205 220,152 103,698 292,876 198,846 535,856 500,157 462,864 502,977 202,007 353,119 364,631 379,571 295,824 283,784 332,439 242,767 266,904 261,866
zma-miR166a-5p GGAAUGUUGUCUGGCUCGGGG 21 600 6 93 1    93 3 1 1 1 2 6 1 0 1 1 28 1 1 1 0 1 4 0 0 0 0 2 1 5 4 2 6 3 3 2 0 13 1 1 0 0 1 0 2 4 1 8 4 2 2 2 0 1 4 1 4 11 0 6 2 0 12 3 3 2 2 1 0 0 1 1 0 1 1 0 2 3 4 2 13 37 19 33 13 24 26 32 30 30 3 7 6 7 8 3 7 6 5 3 6
zma-miR166b-3p UCGGACCAGGCUUCAUUCCC 20 93,004 969 5,143 21    1,513 674 129 32 72 76 38 73 55 80 39 928 755 853 189 227 61 85 95 85 68 36 1,041 1,252 445 471 97 101 61 79 64 21 523 2,013 643 842 193 2,354 1,844 1,249 1,210 804 576 215 213 140 56 1,501 1,117 796 279 86 1,288 874 447 488 474 735 710 1,506 815 1,554 717 451 469 933 291 579 357 307 353 545 428 424 227 2,643 2,616 2,493 1,698 707 1,716 1,174 2,436 2,401 2,576 3,838 2,662 5,143 3,489 2,357 2,651 2,531 3,023 2,005 1,747 1,677
zma-miR166b-5p GGAAUGUUGUCUGGUUCAAGG 21 15,254 159 767 1    513 284 28 90 13 37 20 1 5 0 0 279 31 37 42 2 7 1 0 0 0 0 143 169 318 336 62 53 7 14 0 0 88 118 50 59 40 75 47 341 199 142 338 266 94 41 10 232 188 241 50 20 412 71 319 459 98 302 428 452 324 473 43 93 76 158 51 58 110 81 85 219 186 310 11 69 58 17 27 18 62 27 42 21 88 704 583 270 608 417 267 767 441 197 340 281
zma-miR166c-3p UCGGACCAGGCUUCAUUCCC 20 93,004 969 5,143 21    1,513 674 129 32 72 76 38 73 55 80 39 928 755 853 189 227 61 85 95 85 68 36 1,041 1,252 445 471 97 101 61 79 64 21 523 2,013 643 842 193 2,354 1,844 1,249 1,210 804 576 215 213 140 56 1,501 1,117 796 279 86 1,288 874 447 488 474 735 710 1,506 815 1,554 717 451 469 933 291 579 357 307 353 545 428 424 227 2,643 2,616 2,493 1,698 707 1,716 1,174 2,436 2,401 2,576 3,838 2,662 5,143 3,489 2,357 2,651 2,531 3,023 2,005 1,747 1,677
zma-miR166c-5p GGAAUGUUGUCUGGCUCGAGG 21 1,219 13 74 1    38 21 5 9 3 6 4 1 5 2 7 30 40 22 9 7 5 5 11 8 1 5 5 4 22 17 10 14 27 27 5 5 20 40 9 7 12 7 1 15 18 5 9 7 4 1 3 2 1 1 2 1 74 10 35 29 12 69 15 27 12 24 3 4 7 13 3 3 6 4 3 5 4 12 7 11 20 8 17 4 11 9 12 10 22 27 21 9 26 15 5 33 14 4 10 5
zma-miR166d-3p UCGGACCAGGCUUCAUUCCC 20 93,004 969 5,143 21    1,513 674 129 32 72 76 38 73 55 80 39 928 755 853 189 227 61 85 95 85 68 36 1,041 1,252 445 471 97 101 61 79 64 21 523 2,013 643 842 193 2,354 1,844 1,249 1,210 804 576 215 213 140 56 1,501 1,117 796 279 86 1,288 874 447 488 474 735 710 1,506 815 1,554 717 451 469 933 291 579 357 307 353 545 428 424 227 2,643 2,616 2,493 1,698 707 1,716 1,174 2,436 2,401 2,576 3,838 2,662 5,143 3,489 2,357 2,651 2,531 3,023 2,005 1,747 1,677
zma-miR166d-5p GGAAUGUUGUCUGGUUCAAGG 21 15,254 159 767 1    513 284 28 90 13 37 20 1 5 0 0 279 31 37 42 2 7 1 0 0 0 0 143 169 318 336 62 53 7 14 0 0 88 118 50 59 40 75 47 341 199 142 338 266 94 41 10 232 188 241 50 20 412 71 319 459 98 302 428 452 324 473 43 93 76 158 51 58 110 81 85 219 186 310 11 69 58 17 27 18 62 27 42 21 88 704 583 270 608 417 267 767 441 197 340 281
zma-miR166e UCGGACCAGGCUUCAUUCCC 20 93,004 969 5,143 21    1,513 674 129 32 72 76 38 73 55 80 39 928 755 853 189 227 61 85 95 85 68 36 1,041 1,252 445 471 97 101 61 79 64 21 523 2,013 643 842 193 2,354 1,844 1,249 1,210 804 576 215 213 140 56 1,501 1,117 796 279 86 1,288 874 447 488 474 735 710 1,506 815 1,554 717 451 469 933 291 579 357 307 353 545 428 424 227 2,643 2,616 2,493 1,698 707 1,716 1,174 2,436 2,401 2,576 3,838 2,662 5,143 3,489 2,357 2,651 2,531 3,023 2,005 1,747 1,677
zma-miR166f UCGGACCAGGCUUCAUUCCC 20 93,004 969 5,143 21    1,513 674 129 32 72 76 38 73 55 80 39 928 755 853 189 227 61 85 95 85 68 36 1,041 1,252 445 471 97 101 61 79 64 21 523 2,013 643 842 193 2,354 1,844 1,249 1,210 804 576 215 213 140 56 1,501 1,117 796 279 86 1,288 874 447 488 474 735 710 1,506 815 1,554 717 451 469 933 291 579 357 307 353 545 428 424 227 2,643 2,616 2,493 1,698 707 1,716 1,174 2,436 2,401 2,576 3,838 2,662 5,143 3,489 2,357 2,651 2,531 3,023 2,005 1,747 1,677
zma-miR166g-3p UCGGACCAGGCUUCAUUCCC 20 93,004 969 5,143 21    1,513 674 129 32 72 76 38 73 55 80 39 928 755 853 189 227 61 85 95 85 68 36 1,041 1,252 445 471 97 101 61 79 64 21 523 2,013 643 842 193 2,354 1,844 1,249 1,210 804 576 215 213 140 56 1,501 1,117 796 279 86 1,288 874 447 488 474 735 710 1,506 815 1,554 717 451 469 933 291 579 357 307 353 545 428 424 227 2,643 2,616 2,493 1,698 707 1,716 1,174 2,436 2,401 2,576 3,838 2,662 5,143 3,489 2,357 2,651 2,531 3,023 2,005 1,747 1,677
zma-miR166g-5p GGAAUGUUGUCUGGUUGGAGA 21 589 6 58 1    3 4 1 1 1 4 4 1 2 5 0 1 0 3 1 1 0 4 3 1 0 0 0 3 8 6 6 5 9 5 6 0 57 26 4 6 17 3 1 41 58 30 4 2 4 8 4 2 1 4 2 1 5 1 13 11 11 3 3 10 7 17 2 7 5 4 1 6 2 5 6 1 2 1 2 7 2 1 1 3 5 2 10 7 6 7 13 4 8 2 6 7 5 1 3 1
zma-miR166h-3p UCGGACCAGGCUUCAUUCCC 20 93,004 969 5,143 21    1,513 674 129 32 72 76 38 73 55 80 39 928 755 853 189 227 61 85 95 85 68 36 1,041 1,252 445 471 97 101 61 79 64 21 523 2,013 643 842 193 2,354 1,844 1,249 1,210 804 576 215 213 140 56 1,501 1,117 796 279 86 1,288 874 447 488 474 735 710 1,506 815 1,554 717 451 469 933 291 579 357 307 353 545 428 424 227 2,643 2,616 2,493 1,698 707 1,716 1,174 2,436 2,401 2,576 3,838 2,662 5,143 3,489 2,357 2,651 2,531 3,023 2,005 1,747 1,677
zma-miR166h-5p GGAAUGACGUCCGGUCCGAAC 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
zma-miR166i-3p UCGGACCAGGCUUCAUUCCC 20 93,004 969 5,143 21    1,513 674 129 32 72 76 38 73 55 80 39 928 755 853 189 227 61 85 95 85 68 36 1,041 1,252 445 471 97 101 61 79 64 21 523 2,013 643 842 193 2,354 1,844 1,249 1,210 804 576 215 213 140 56 1,501 1,117 796 279 86 1,288 874 447 488 474 735 710 1,506 815 1,554 717 451 469 933 291 579 357 307 353 545 428 424 227 2,643 2,616 2,493 1,698 707 1,716 1,174 2,436 2,401 2,576 3,838 2,662 5,143 3,489 2,357 2,651 2,531 3,023 2,005 1,747 1,677
zma-miR166i-5p GGAAUGUCGUCUGGCGCGAGA 21 36 0 4 1    0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 4 0 0 1 0 0 1 1 1 1 0 1 0 1 0 0 0 1 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 1 1 3 1 2 1 3 0 0 1 0 1 0 0 0 0 0 1
zma-miR166j-3p UCGGACCAGGCUUCAAUCCCU 21 457,127 4,762 25,820 2    13,566 4,829 1,309 385 1,085 580 297 295 224 131 2 7,467 11,011 9,760 2,188 2,996 1,851 1,765 2,270 1,783 547 4 6,690 7,167 2,348 4,253 639 591 536 503 224 4 7,228 11,490 8,338 4,536 691 12,199 5,711 7,438 8,120 5,745 5,350 1,023 2,499 1,559 725 25,820 24,059 22,054 6,072 1,474 2,763 3,311 2,474 2,700 2,245 2,535 6,426 8,028 6,406 8,379 5,201 3,590 2,663 5,574 1,742 2,047 2,394 2,030 1,999 5,999 4,250 5,017 1,201 8,966 9,976 15,164 8,762 2,824 7,771 5,170 6,792 6,235 8,177 5,853 2,944 2,871 4,781 3,303 3,398 3,509 4,392 2,509 3,008 2,317
zma-miR166j-5p GGUUUGUUUGUCUGGUUCAAGG 22 1,411 15 81 1    81 19 2 18 1 9 5 0 1 1 0 27 21 8 6 3 1 1 0 1 0 0 17 16 50 31 6 11 0 1 0 0 28 31 21 13 8 3 5 39 33 15 26 74 7 2 3 40 23 31 7 7 44 8 27 44 6 42 52 40 31 40 3 6 5 5 3 4 7 6 7 26 7 21 1 11 3 6 6 1 6 4 5 2 3 26 12 11 29 21 11 23 19 5 10 9
zma-miR166k-3p UCGGACCAGGCUUCAAUCCCU 21 457,127 4,762 25,820 2    13,566 4,829 1,309 385 1,085 580 297 295 224 131 2 7,467 11,011 9,760 2,188 2,996 1,851 1,765 2,270 1,783 547 4 6,690 7,167 2,348 4,253 639 591 536 503 224 4 7,228 11,490 8,338 4,536 691 12,199 5,711 7,438 8,120 5,745 5,350 1,023 2,499 1,559 725 25,820 24,059 22,054 6,072 1,474 2,763 3,311 2,474 2,700 2,245 2,535 6,426 8,028 6,406 8,379 5,201 3,590 2,663 5,574 1,742 2,047 2,394 2,030 1,999 5,999 4,250 5,017 1,201 8,966 9,976 15,164 8,762 2,824 7,771 5,170 6,792 6,235 8,177 5,853 2,944 2,871 4,781 3,303 3,398 3,509 4,392 2,509 3,008 2,317
zma-miR166k-5p GGAUUGUUGUCUGGCUCGGGG 21 7,832 82 775 1    716 25 8 2 1 1 0 0 0 0 0 440 44 20 7 5 1 0 0 0 0 0 70 85 41 43 2 1 1 0 0 0 115 158 14 8 5 85 31 205 168 99 86 31 17 7 3 106 59 53 26 9 656 13 28 17 5 775 158 113 46 45 12 8 9 23 4 3 8 2 2 28 15 15 28 63 394 427 384 101 100 96 113 89 96 144 112 64 164 81 77 169 126 57 104 60
zma-miR166l-3p UCGGACCAGGCUUCAUUCCUC 21 486,257 5,065 24,103 1    5,780 3,400 807 221 567 475 374 526 469 261 3 3,855 4,239 4,714 916 974 452 511 805 677 241 4 7,668 8,105 1,800 3,201 483 595 652 608 314 1 3,490 6,661 5,563 3,700 1,618 17,401 6,605 9,785 11,179 7,841 3,430 1,583 2,766 1,503 587 20,488 24,103 19,133 5,042 1,215 7,262 3,271 3,719 3,343 2,417 6,359 6,280 8,101 5,736 8,299 4,864 3,462 2,972 5,109 2,007 2,431 2,199 1,924 1,839 2,228 2,135 2,193 1,449 12,306 6,899 10,882 5,971 2,095 5,794 3,715 4,334 4,300 5,254 18,718 9,160 14,093 13,910 11,085 11,967 10,935 12,338 8,132 9,623 7,756
zma-miR166l-5p GAAUGGAGGCUGGUCCAAGA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR166m-3p UCGGACCAGGCUUCAUUCCUC 21 486,257 5,065 24,103 1    5,780 3,400 807 221 567 475 374 526 469 261 3 3,855 4,239 4,714 916 974 452 511 805 677 241 4 7,668 8,105 1,800 3,201 483 595 652 608 314 1 3,490 6,661 5,563 3,700 1,618 17,401 6,605 9,785 11,179 7,841 3,430 1,583 2,766 1,503 587 20,488 24,103 19,133 5,042 1,215 7,262 3,271 3,719 3,343 2,417 6,359 6,280 8,101 5,736 8,299 4,864 3,462 2,972 5,109 2,007 2,431 2,199 1,924 1,839 2,228 2,135 2,193 1,449 12,306 6,899 10,882 5,971 2,095 5,794 3,715 4,334 4,300 5,254 18,718 9,160 14,093 13,910 11,085 11,967 10,935 12,338 8,132 9,623 7,756
zma-miR166m-5p GGAAUGUUGGCUGGCUCGAGG 21 7,263 76 796 1    419 114 17 12 6 9 5 1 1 0 0 295 68 59 13 3 5 3 1 0 0 0 33 25 32 42 8 4 4 4 0 0 137 120 18 12 21 43 11 102 76 49 394 148 47 11 5 124 51 38 15 7 796 28 65 43 8 599 103 84 33 43 31 28 32 31 9 12 15 10 8 30 10 8 17 162 406 242 342 69 143 115 218 121 203 103 96 28 106 49 31 73 29 20 24 28
zma-miR166n-3p UCGGACCAGGCUUCAAUCCCU 21 457,127 4,762 25,820 2    13,566 4,829 1,309 385 1,085 580 297 295 224 131 2 7,467 11,011 9,760 2,188 2,996 1,851 1,765 2,270 1,783 547 4 6,690 7,167 2,348 4,253 639 591 536 503 224 4 7,228 11,490 8,338 4,536 691 12,199 5,711 7,438 8,120 5,745 5,350 1,023 2,499 1,559 725 25,820 24,059 22,054 6,072 1,474 2,763 3,311 2,474 2,700 2,245 2,535 6,426 8,028 6,406 8,379 5,201 3,590 2,663 5,574 1,742 2,047 2,394 2,030 1,999 5,999 4,250 5,017 1,201 8,966 9,976 15,164 8,762 2,824 7,771 5,170 6,792 6,235 8,177 5,853 2,944 2,871 4,781 3,303 3,398 3,509 4,392 2,509 3,008 2,317
zma-miR166n-5p GGAUUGUUGUCUGGCUCGGUG 21 6,305 66 673 1    673 17 17 3 4 4 2 0 0 0 1 307 29 11 1 1 1 0 1 1 1 0 59 60 44 54 4 5 0 0 0 0 43 8 6 11 4 41 16 168 160 62 90 56 5 2 1 592 98 99 24 9 193 6 6 20 4 256 78 66 78 80 9 4 7 38 5 7 8 4 6 47 16 21 7 72 258 192 134 73 108 79 216 65 97 196 141 58 273 147 87 107 66 39 64 72
zma-miR167a-3p GAUCAUGCAUGACAGCCUCAUU 22 56 1 5 1    0 0 0 1 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 2 0 1 1 1 0 0 0 0 0 1 1 1 1 4 5 2 1 1 0 1 1 1 1 1 2 3 0 0 0 1 0 1 0 2 1 3 1 0 0 0 0 0 0 0 1 1 1 1 1 1 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 1 0 0 0
zma-miR167a-5p UGAAGCUGCCAGCAUGAUCUA 21 11,880 124 709 4    437 206 44 22 14 23 9 8 6 11 0 301 101 54 14 8 10 10 8 7 6 0 237 170 219 239 22 29 22 45 9 0 32 153 228 109 90 709 331 362 696 545 156 14 30 84 33 275 199 179 62 28 186 196 265 232 141 410 266 516 243 416 150 99 86 138 62 50 94 61 72 84 88 134 4 109 32 29 14 6 11 13 9 12 14 161 97 111 49 120 86 97 86 67 91 67
zma-miR167b-3p GAUCAUGCUGUGACAGUUUCACU 23 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR167b-5p UGAAGCUGCCAGCAUGAUCUA 21 11,880 124 709 4    437 206 44 22 14 23 9 8 6 11 0 301 101 54 14 8 10 10 8 7 6 0 237 170 219 239 22 29 22 45 9 0 32 153 228 109 90 709 331 362 696 545 156 14 30 84 33 275 199 179 62 28 186 196 265 232 141 410 266 516 243 416 150 99 86 138 62 50 94 61 72 84 88 134 4 109 32 29 14 6 11 13 9 12 14 161 97 111 49 120 86 97 86 67 91 67
zma-miR167c-3p GAUCAUGCUGUGGCAGCCUCACU 23 8,066 84 1,553 1    134 43 57 18 25 16 5 1 0 2 0 57 33 38 15 6 10 8 3 4 5 0 59 26 75 107 15 19 1 25 13 0 298 132 6 32 110 576 145 1,553 1,435 468 37 2 13 7 4 162 54 51 18 14 87 14 35 65 44 67 247 248 312 472 16 11 12 36 8 9 15 5 6 15 7 10 33 31 20 16 6 3 6 7 11 4 10 24 22 24 34 35 36 18 15 9 14 10
zma-miR167c-5p UGAAGCUGCCAGCAUGAUCUA 21 11,880 124 709 4    437 206 44 22 14 23 9 8 6 11 0 301 101 54 14 8 10 10 8 7 6 0 237 170 219 239 22 29 22 45 9 0 32 153 228 109 90 709 331 362 696 545 156 14 30 84 33 275 199 179 62 28 186 196 265 232 141 410 266 516 243 416 150 99 86 138 62 50 94 61 72 84 88 134 4 109 32 29 14 6 11 13 9 12 14 161 97 111 49 120 86 97 86 67 91 67
zma-miR167d-3p GGUCAUGCUGCUGCAGCCUCACU 23 188 2 21 1    7 1 1 1 1 1 0 0 0 0 0 4 3 2 0 3 0 1 0 0 0 0 2 1 1 4 0 0 0 1 0 0 0 1 1 0 2 9 5 16 15 4 0 0 0 1 1 6 2 2 2 6 6 0 1 4 4 21 7 4 4 5 1 1 1 1 0 1 0 1 1 0 1 1 2 1 0 0 1 0 0 1 1 1 0 1 1 1 1 1 1 2 0 0 1 0
zma-miR167d-5p UGAAGCUGCCAGCAUGAUCUA 21 11,880 124 709 4    437 206 44 22 14 23 9 8 6 11 0 301 101 54 14 8 10 10 8 7 6 0 237 170 219 239 22 29 22 45 9 0 32 153 228 109 90 709 331 362 696 545 156 14 30 84 33 275 199 179 62 28 186 196 265 232 141 410 266 516 243 416 150 99 86 138 62 50 94 61 72 84 88 134 4 109 32 29 14 6 11 13 9 12 14 161 97 111 49 120 86 97 86 67 91 67
zma-miR167e-3p GAUCAUGCUGUGCAGUUUCAUC 22 18 0 5 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 2 3 5 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0
zma-miR167e-5p UGAAGCUGCCAGCAUGAUCUG 21 3,963 41 216 1    1 7 2 4 11 7 3 23 26 96 4 2 9 10 14 11 9 11 55 78 67 4 13 30 72 69 11 12 46 124 210 3 56 63 19 22 20 140 137 144 216 194 3 3 9 24 6 17 17 30 38 13 9 27 25 21 24 46 19 79 86 133 11 7 9 16 10 16 14 12 9 3 2 5 20 91 13 35 12 8 13 8 22 33 40 99 71 131 70 150 29 80 56 65 54 65
zma-miR167f-3p GAUCGUGCUGCGCAGUUUCACC 22 9 0 5 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 5 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
zma-miR167f-5p UGAAGCUGCCAGCAUGAUCUG 21 3,963 41 216 1    1 7 2 4 11 7 3 23 26 96 4 2 9 10 14 11 9 11 55 78 67 4 13 30 72 69 11 12 46 124 210 3 56 63 19 22 20 140 137 144 216 194 3 3 9 24 6 17 17 30 38 13 9 27 25 21 24 46 19 79 86 133 11 7 9 16 10 16 14 12 9 3 2 5 20 91 13 35 12 8 13 8 22 33 40 99 71 131 70 150 29 80 56 65 54 65
zma-miR167g-3p GGUCAUGCUGUAGUUUCAUC 20 40 0 3 1    0 0 0 1 1 0 0 0 0 0 0 0 3 0 0 0 1 0 3 1 0 0 1 0 0 1 0 0 0 0 1 0 0 0 0 1 1 0 1 2 3 2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 1 3 0 0 1 0 1 1 0 0 1 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 1 1 0 1 0 0 0 0 1 0
zma-miR167g-5p UGAAGCUGCCAGCAUGAUCUG 21 3,963 41 216 1    1 7 2 4 11 7 3 23 26 96 4 2 9 10 14 11 9 11 55 78 67 4 13 30 72 69 11 12 46 124 210 3 56 63 19 22 20 140 137 144 216 194 3 3 9 24 6 17 17 30 38 13 9 27 25 21 24 46 19 79 86 133 11 7 9 16 10 16 14 12 9 3 2 5 20 91 13 35 12 8 13 8 22 33 40 99 71 131 70 150 29 80 56 65 54 65
zma-miR167h-3p GAUCAUGUUGCAGCUUCAC 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR167h-5p UGAAGCUGCCAGCAUGAUCUG 21 3,963 41 216 1    1 7 2 4 11 7 3 23 26 96 4 2 9 10 14 11 9 11 55 78 67 4 13 30 72 69 11 12 46 124 210 3 56 63 19 22 20 140 137 144 216 194 3 3 9 24 6 17 17 30 38 13 9 27 25 21 24 46 19 79 86 133 11 7 9 16 10 16 14 12 9 3 2 5 20 91 13 35 12 8 13 8 22 33 40 99 71 131 70 150 29 80 56 65 54 65
zma-miR167i-3p GAUCAUGUUGCAGCUUCAC 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR167i-5p UGAAGCUGCCAGCAUGAUCUG 21 3,963 41 216 1    1 7 2 4 11 7 3 23 26 96 4 2 9 10 14 11 9 11 55 78 67 4 13 30 72 69 11 12 46 124 210 3 56 63 19 22 20 140 137 144 216 194 3 3 9 24 6 17 17 30 38 13 9 27 25 21 24 46 19 79 86 133 11 7 9 16 10 16 14 12 9 3 2 5 20 91 13 35 12 8 13 8 22 33 40 99 71 131 70 150 29 80 56 65 54 65
zma-miR167j-3p GAUCAUGUGGCAGUUUCAUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR167j-5p UGAAGCUGCCAGCAUGAUCUG 21 3,963 41 216 1    1 7 2 4 11 7 3 23 26 96 4 2 9 10 14 11 9 11 55 78 67 4 13 30 72 69 11 12 46 124 210 3 56 63 19 22 20 140 137 144 216 194 3 3 9 24 6 17 17 30 38 13 9 27 25 21 24 46 19 79 86 133 11 7 9 16 10 16 14 12 9 3 2 5 20 91 13 35 12 8 13 8 22 33 40 99 71 131 70 150 29 80 56 65 54 65
zma-miR168a-3p CCCGCCUUGCACCAAGUGAA 20 2,617 27 1,505 1    19 1 1 1 5 5 6 1 7 2 176 7 28 17 23 29 65 1,505 30 192 5 76 1 1 12 6 9 3 3 8 11 66 10 4 1 2 8 5 2 8 27 17 3 1 4 5 2 1 2 6 5 6 4 2 2 4 3 11 4 4 4 5 1 0 1 1 1 1 1 1 2 0 1 1 64 2 10 9 3 3 5 4 1 4 2 0 2 3 1 3 1 4 0 0 1 1
zma-miR168a-5p UCGCUUGGUGCAGAUCGGGAC 21 283,348 2,952 22,354 28    5,254 984 951 580 999 577 445 149 28 304 2,377 4,934 3,391 3,867 2,653 2,381 4,076 11,949 2,707 4,399 2,264 4,660 614 1,324 3,199 2,605 731 754 408 586 1,515 1,037 4,694 6,512 2,062 2,314 410 1,030 738 3,558 6,345 3,133 616 691 2,376 645 291 2,317 4,397 5,523 2,378 1,313 426 255 543 614 350 514 1,317 1,352 2,449 1,807 248 435 415 2,103 677 1,280 2,166 1,492 2,127 1,091 1,822 1,232 8,105 7,852 10,454 22,354 7,331 4,291 12,901 6,947 7,796 4,068 7,758 4,920 2,490 2,715 4,625 3,116 2,684 3,581 3,947 2,300 2,721 1,632
zma-miR168b-3p CCCGCCUUGCAUCAAGUGAA 20 1,009 11 132 1    7 6 2 1 2 4 1 1 0 5 1 9 46 24 33 21 42 132 10 73 3 0 2 2 30 13 5 6 2 5 12 0 1 1 1 2 4 10 5 14 37 14 4 3 8 3 2 8 5 10 5 11 11 3 4 4 0 10 5 11 9 10 0 1 0 3 0 2 1 2 1 0 1 2 29 13 30 22 8 4 23 12 24 10 28 3 7 16 5 8 5 21 4 4 3 2
zma-miR168b-5p UCGCUUGGUGCAGAUCGGGAC 21 283,348 2,952 22,354 28    5,254 984 951 580 999 577 445 149 28 304 2,377 4,934 3,391 3,867 2,653 2,381 4,076 11,949 2,707 4,399 2,264 4,660 614 1,324 3,199 2,605 731 754 408 586 1,515 1,037 4,694 6,512 2,062 2,314 410 1,030 738 3,558 6,345 3,133 616 691 2,376 645 291 2,317 4,397 5,523 2,378 1,313 426 255 543 614 350 514 1,317 1,352 2,449 1,807 248 435 415 2,103 677 1,280 2,166 1,492 2,127 1,091 1,822 1,232 8,105 7,852 10,454 22,354 7,331 4,291 12,901 6,947 7,796 4,068 7,758 4,920 2,490 2,715 4,625 3,116 2,684 3,581 3,947 2,300 2,721 1,632
zma-miR169a-3p GGCAAGUUGUUCUUGGCUACA 21 5 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169a-5p CAGCCAAGGAUGACUUGCCGA 21 312 3 16 1    0 2 4 3 4 7 3 0 0 0 0 2 8 3 2 3 3 4 3 1 0 0 4 4 10 12 4 3 3 3 1 0 0 0 3 0 2 3 1 2 3 3 1 1 1 3 3 1 7 3 2 3 3 4 13 16 5 5 9 5 2 7 2 3 3 7 4 2 8 5 11 3 1 7 0 6 1 1 1 1 0 0 1 0 1 6 7 4 2 2 5 4 3 2 1 1
zma-miR169b-3p GGCAAGUUGUUCUUGGCUACA 21 5 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169b-5p CAGCCAAGGAUGACUUGCCGA 21 312 3 16 1    0 2 4 3 4 7 3 0 0 0 0 2 8 3 2 3 3 4 3 1 0 0 4 4 10 12 4 3 3 3 1 0 0 0 3 0 2 3 1 2 3 3 1 1 1 3 3 1 7 3 2 3 3 4 13 16 5 5 9 5 2 7 2 3 3 7 4 2 8 5 11 3 1 7 0 6 1 1 1 1 0 0 1 0 1 6 7 4 2 2 5 4 3 2 1 1
zma-miR169c-3p GGCAAGUCUGUCCUUGGCUACA 22 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169c-5p CAGCCAAGGAUGACUUGCCGG 21 26 0 2 1    0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 1 1 0 0 0 0 0 1 1 0 1 0 2 1 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 1 1 1 0 1 0 0 0 0 1 0 0 1 0 1 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0
zma-miR169d UAGCCAAGGAGACUGCCUAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169e UAGCCAAGGAGACUGCCUACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169f-3p GGCAUGUCUUCCUUGGCUACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169f-5p UAGCCAAGGAUGACUUGCCUA 21 13 0 1 1    0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 1 1 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169g UAGCCAAGGAUGACUUGCCUA 21 13 0 1 1    0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 1 1 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169h UAGCCAAGGAUGACUUGCCUA 21 13 0 1 1    0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 1 1 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169i-3p GGCAGUCUCCUUGGCUAG 18 50 1 13 1    0 0 0 0 1