Maize miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  Zma1Zma2Zma3Smop1SwtMzSeShootsMzSeRootsMzEarMzPollenMzRootsMzSeedlingsMzTasselht_rmr2_1ho_rmr2_1WT_h1_rp1hen1_rp1Out_ear_UnfrtEar1_mop1Ear2_mop1Ear1_ControlEar2_Control
zma-miR11969-3p UUAUACCCAUCUCUCACCUUGCAA 24 1 1 1 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR11969-5p GCAAGGUCAGAGAAGGAUAUAAUC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR11970-3p UGGUUUGGUUGCACGUUUGCA 21 74 5 20 1    1 1 0 3 1 2 12 1 1 20 14 7 0 0 2 1 0 8 0 0 0
zma-miR11970-5p CAAGCGUGCAAGCAAACCAUU 21 15 2 4 1    0 0 0 0 0 1 0 1 3 4 1 2 1 0 0 0 1 0 0 0 1
zma-miR1432-3p GGGUGUCAUCUCGCCUGAAGCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR1432-5p CUCAGGAGAGAUGACACCGAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR156a-3p GCUCACUUCUCUCUCUGUCAGU 22 202 29 102 3    0 0 0 0 0 10 4 0 3 68 102 0 0 0 3 12 0 0 0 0 0
zma-miR156a-5p UGACAGAAGAGAGUGAGCAC 20 839,206 39,962 342,883 10    133,163 143 410 653 79 342,883 270,337 236 990 7,458 16,555 150 198 61 984 54,428 10,084 190 182 10 12
zma-miR156b-3p GCUCACCCUCUAUCUGUCAGU 21 3,542 295 1,154 10    0 0 0 0 0 217 436 0 30 853 67 10 0 0 13 130 0 565 1,154 19 48
zma-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 839,206 39,962 342,883 10    133,163 143 410 653 79 342,883 270,337 236 990 7,458 16,555 150 198 61 984 54,428 10,084 190 182 10 12
zma-miR156c UGACAGAAGAGAGUGAGCAC 20 839,206 39,962 342,883 10    133,163 143 410 653 79 342,883 270,337 236 990 7,458 16,555 150 198 61 984 54,428 10,084 190 182 10 12
zma-miR156d-3p GCUCACUUCUCUUUCUGUCAGC 22 6,875 430 5,194 1    28 0 2 2 1 135 703 1 1 119 202 1 4 17 190 5,194 275 0 0 0 0
zma-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 839,206 39,962 342,883 10    133,163 143 410 653 79 342,883 270,337 236 990 7,458 16,555 150 198 61 984 54,428 10,084 190 182 10 12
zma-miR156e-3p GCUCACUGCUCUCUCUGUCAUC 22 449 56 386 1    2 0 0 0 0 1 0 1 1 14 25 0 0 0 19 386 0 0 0 0 0
zma-miR156e-5p UGACAGAAGAGAGUGAGCAC 20 839,206 39,962 342,883 10    133,163 143 410 653 79 342,883 270,337 236 990 7,458 16,555 150 198 61 984 54,428 10,084 190 182 10 12
zma-miR156f-3p GCUCACUUCUCUUUCUGUCAGC 22 6,875 430 5,194 1    28 0 2 2 1 135 703 1 1 119 202 1 4 17 190 5,194 275 0 0 0 0
zma-miR156f-5p UGACAGAAGAGAGUGAGCAC 20 839,206 39,962 342,883 10    133,163 143 410 653 79 342,883 270,337 236 990 7,458 16,555 150 198 61 984 54,428 10,084 190 182 10 12
zma-miR156g-3p GCUCACUUCUCUUUCUGUCAGC 22 6,875 430 5,194 1    28 0 2 2 1 135 703 1 1 119 202 1 4 17 190 5,194 275 0 0 0 0
zma-miR156g-5p UGACAGAAGAGAGUGAGCAC 20 839,206 39,962 342,883 10    133,163 143 410 653 79 342,883 270,337 236 990 7,458 16,555 150 198 61 984 54,428 10,084 190 182 10 12
zma-miR156h-3p GCUCACUGCUCUUUCUGUCAUC 22 185 15 67 1    0 0 0 1 0 21 6 0 10 67 5 1 1 1 8 61 3 0 0 0 0
zma-miR156h-5p UGACAGAAGAGAGUGAGCAC 20 839,206 39,962 342,883 10    133,163 143 410 653 79 342,883 270,337 236 990 7,458 16,555 150 198 61 984 54,428 10,084 190 182 10 12
zma-miR156i-3p GCUCACUGCUCUAUCUGUCAUC 22 223 20 74 1    0 0 0 2 0 24 12 0 59 4 16 1 5 1 25 74 0 0 0 0 0
zma-miR156i-5p UGACAGAAGAGAGUGAGCAC 20 839,206 39,962 342,883 10    133,163 143 410 653 79 342,883 270,337 236 990 7,458 16,555 150 198 61 984 54,428 10,084 190 182 10 12
zma-miR156j-3p UGCUCUCUGCUCUCACUGUCAUC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR156j-5p UGACAGAAGAGAGAGAGCACA 21 28 7 21 1    0 0 0 0 0 0 4 0 0 1 0 0 0 0 0 2 21 0 0 0 0
zma-miR156k-3p GCUCGCUUCUCUUUCUGUCAGC 22 698 63 358 1    1 0 0 1 0 12 247 0 0 16 16 0 1 1 33 358 12 0 0 0 0
zma-miR156k-5p UGACAGAAGAGAGCGAGCAC 20 27,442 1,372 12,434 1    2,369 8 11 21 1 12,434 9,910 11 4 177 430 6 22 6 65 1,512 438 0 10 5 2
zma-miR156l-3p GCUCACUGCUCUAUCUGUCACC 22 845 56 331 1    0 0 1 6 0 147 263 1 3 9 28 1 4 5 31 331 10 0 5 0 0
zma-miR156l-5p UGACAGAAGAGAGUGAGCAC 20 839,206 39,962 342,883 10    133,163 143 410 653 79 342,883 270,337 236 990 7,458 16,555 150 198 61 984 54,428 10,084 190 182 10 12
zma-miR159a-3p UUUGGAUUGAAGGGAGCUCUG 21 229,186 10,914 121,778 134    861 179 160 322 134 2,084 14,847 3,131 1,151 8,783 18,167 6,056 139 193 11,260 11,888 121,778 10,119 11,249 2,868 3,817
zma-miR159a-5p GAGCUCCUAUCAUUCCAAUGA 21 4,016 251 2,138 1    2 1 1 0 0 2 4 3 0 6 14 5 0 0 1,469 2,138 3 85 122 72 89
zma-miR159b-3p UUUGGAUUGAAGGGAGCUCUG 21 229,186 10,914 121,778 134    861 179 160 322 134 2,084 14,847 3,131 1,151 8,783 18,167 6,056 139 193 11,260 11,888 121,778 10,119 11,249 2,868 3,817
zma-miR159b-5p GUGCUCCCUUCAAACCAAUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159c-3p CUUGGAUUGAAGGGAGCUCCU 21 234 29 129 1    0 0 0 0 0 0 129 0 0 0 0 0 0 0 4 1 61 12 20 5 2
zma-miR159c-5p GAGCUCCCUUCGAUCCAAUCC 21 22 6 11 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 8 11 0 2
zma-miR159d-3p CUUGGAUUGAAGGGAGCUCCU 21 234 29 129 1    0 0 0 0 0 0 129 0 0 0 0 0 0 0 4 1 61 12 20 5 2
zma-miR159d-5p GAGCUCCCUUCGAUCCAAUCC 21 22 6 11 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 8 11 0 2
zma-miR159e-3p AUUGGUUUGAAGGGAGCUCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159e-5p CAGCUCCUGCAGCAUCUGUUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159f-3p UUUGGAUUGAAGGGAGCUCUG 21 229,186 10,914 121,778 134    861 179 160 322 134 2,084 14,847 3,131 1,151 8,783 18,167 6,056 139 193 11,260 11,888 121,778 10,119 11,249 2,868 3,817
zma-miR159f-5p GAGCUCCUCUCAUUCCAAUGA 21 81 16 52 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 52 8 2 0 18 0 1
zma-miR159g-3p UUUGGAGUGAAGGGAGUUCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159g-5p GUGCUCCCUUCACACCAAUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159h-3p UUUGGAGUGAAGGGAGCUCUG 21 265 20 206 1    0 0 0 0 0 0 0 2 206 6 18 10 1 1 1 1 1 8 8 0 2
zma-miR159h-5p GUGCUCCCUUCACACCAAUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159i-3p UUUGGAGUGAAGGGAGCUCUG 21 265 20 206 1    0 0 0 0 0 0 0 2 206 6 18 10 1 1 1 1 1 8 8 0 2
zma-miR159i-5p GUGCUCCCUUCACACCAAUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159j-3p UUUGGAUUGAAGGGAGCUCUG 21 229,186 10,914 121,778 134    861 179 160 322 134 2,084 14,847 3,131 1,151 8,783 18,167 6,056 139 193 11,260 11,888 121,778 10,119 11,249 2,868 3,817
zma-miR159j-5p GUGCUCCCUUCAAACCAAUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159k-3p UUUGGAUUGAAGGGAGCUCUG 21 229,186 10,914 121,778 134    861 179 160 322 134 2,084 14,847 3,131 1,151 8,783 18,167 6,056 139 193 11,260 11,888 121,778 10,119 11,249 2,868 3,817
zma-miR159k-5p GUGCUCCCUUCAAACCAAUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR160a-3p GCGUGCAAGGGGCCAAGCAUG 21 177 16 87 1    0 0 0 0 0 17 4 0 0 87 9 1 1 0 1 5 0 20 25 0 7
zma-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 9,852 469 7,048 1    325 122 71 80 124 422 347 5 1 11 12 29 8 73 733 296 7,048 40 89 5 11
zma-miR160b-3p GCGUGCAAGGAGCCAAGCAUG 21 6,631 316 1,981 5    50 5 25 12 19 104 74 197 16 392 377 113 8 11 48 236 20 1,777 1,981 398 768
zma-miR160b-5p UGCCUGGCUCCCUGUAUGCCA 21 9,852 469 7,048 1    325 122 71 80 124 422 347 5 1 11 12 29 8 73 733 296 7,048 40 89 5 11
zma-miR160c-3p GCGUGCAUGGUGCCAAGCAUA 21 77 10 24 1    0 0 0 1 0 0 0 0 0 0 0 1 0 1 9 11 0 24 23 0 7
zma-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 9,852 469 7,048 1    325 122 71 80 124 422 347 5 1 11 12 29 8 73 733 296 7,048 40 89 5 11
zma-miR160d-3p GCGUGCGUGGAGCCAAGCAUG 21 67 5 28 1    0 1 2 1 0 0 2 2 0 1 1 3 0 3 0 1 0 28 7 10 5
zma-miR160d-5p UGCCUGGCUCCCUGUAUGCCA 21 9,852 469 7,048 1    325 122 71 80 124 422 347 5 1 11 12 29 8 73 733 296 7,048 40 89 5 11
zma-miR160e UGCCUGGCUCCCUGUAUGCCA 21 9,852 469 7,048 1    325 122 71 80 124 422 347 5 1 11 12 29 8 73 733 296 7,048 40 89 5 11
zma-miR160f-3p GCGUGCGAGGUGCCAGGCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR160f-5p UGCCUGGCUCCCUGUAUGCCG 21 86 14 57 1    0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 14 57 0 10 3
zma-miR160g-3p GCGUGCAAGGAGCCAAGCAUG 21 6,631 316 1,981 5    50 5 25 12 19 104 74 197 16 392 377 113 8 11 48 236 20 1,777 1,981 398 768
zma-miR160g-5p UGCCUGGCUCCCUGUAUGCCA 21 9,852 469 7,048 1    325 122 71 80 124 422 347 5 1 11 12 29 8 73 733 296 7,048 40 89 5 11
zma-miR162-3p UCGAUAAACCUCUGCAUCCA 20 237 47 211 1    0 0 0 0 0 0 0 0 0 0 0 1 0 0 20 211 0 4 1 0 0
zma-miR162-5p GGGCGCAGUGGUUUAUCGAUC 21 39 8 13 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 12 11 0 0 13 0 2
zma-miR164a-3p CACGUGUUCUCCUUCUCCAUC 21 281 23 77 1    0 0 0 0 1 0 0 4 0 1 1 5 0 0 3 30 2 77 70 10 77
zma-miR164a-5p UGGAGAAGCAGGGCACGUGCA 21 53,797 2,562 42,029 14    1,125 206 161 31 14 2,456 1,918 371 23 1,305 2,716 468 37 71 281 75 42,029 157 273 19 61
zma-miR164b-3p AUGUGCCCAUCUUCUCCACC 20 35 9 21 1    0 0 0 0 0 1 2 0 0 0 0 0 0 0 21 11 0 0 0 0 0
zma-miR164b-5p UGGAGAAGCAGGGCACGUGCA 21 53,797 2,562 42,029 14    1,125 206 161 31 14 2,456 1,918 371 23 1,305 2,716 468 37 71 281 75 42,029 157 273 19 61
zma-miR164c-3p CAUGUGCCCUUCUUCUCCAUC 21 896 128 469 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 87 469 127 77 105 0 30
zma-miR164c-5p UGGAGAAGCAGGGCACGUGCA 21 53,797 2,562 42,029 14    1,125 206 161 31 14 2,456 1,918 371 23 1,305 2,716 468 37 71 281 75 42,029 157 273 19 61
zma-miR164d-3p CACGUGGUCUCCUUCUCCAU 20 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0
zma-miR164d-5p UGGAGAAGCAGGGCACGUGCA 21 53,797 2,562 42,029 14    1,125 206 161 31 14 2,456 1,918 371 23 1,305 2,716 468 37 71 281 75 42,029 157 273 19 61
zma-miR164e-3p CAUGUGUCCGCCCUCUCCACC 21 2 2 2 2    0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0
zma-miR164e-5p UGGAGAAGCAGGACACGUGAG 21 4,178 279 2,292 1    2,292 5 2 5 0 823 605 0 1 155 59 1 1 1 0 0 195 4 29 0 0
zma-miR164f-3p CACGUGCGCUCCUUCUCCAAC 21 1 1 1 1    0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR164f-5p UGGAGAAGCAGGGCACGUGCU 21 793 50 368 1    19 2 3 0 0 124 155 4 14 368 76 2 1 1 1 3 19 0 1 0 0
zma-miR164g-3p CACGUGCUCCCCUUCUCCACC 21 698 70 202 1    0 0 0 0 0 0 0 0 0 0 1 1 1 0 149 202 4 101 140 5 94
zma-miR164g-5p UGGAGAAGCAGGGCACGUGCA 21 53,797 2,562 42,029 14    1,125 206 161 31 14 2,456 1,918 371 23 1,305 2,716 468 37 71 281 75 42,029 157 273 19 61
zma-miR164h-3p CAUGUGCCCUUCUUCUCCAUC 21 896 128 469 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 87 469 127 77 105 0 30
zma-miR164h-5p UGGAGAAGCAGGGCACGUGUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 1,314,232 62,582 717,656 95    22,605 17,116 22,551 66,875 17,401 23,341 42,301 144 95 617 283 147 1,042 8,332 717,656 340,053 29,138 1,276 2,087 283 889
zma-miR166a-5p GGAAUGUUGUCUGGCUCGGGG 21 337 19 77 1    2 1 8 14 2 11 14 2 0 6 1 2 1 0 73 54 26 28 77 0 15
zma-miR166b-3p UCGGACCAGGCUUCAUUCCC 20 148,793 7,085 134,052 1    170 124 155 1,631 408 211 709 1 1 10 5 7 2 14 10,342 134,052 362 271 217 53 48
zma-miR166b-5p GGAAUGUUGUCUGGUUCAAGG 21 7,025 390 2,366 1    0 4 40 15 0 39 30 33 2 516 85 116 1 0 2,366 821 157 1,280 1,253 86 181
zma-miR166c-3p UCGGACCAGGCUUCAUUCCC 20 148,793 7,085 134,052 1    170 124 155 1,631 408 211 709 1 1 10 5 7 2 14 10,342 134,052 362 271 217 53 48
zma-miR166c-5p GGAAUGUUGUCUGGCUCGAGG 21 1,465 70 346 4    19 20 29 11 4 32 74 15 18 82 12 11 5 6 161 103 60 307 346 38 112
zma-miR166d-3p UCGGACCAGGCUUCAUUCCC 20 148,793 7,085 134,052 1    170 124 155 1,631 408 211 709 1 1 10 5 7 2 14 10,342 134,052 362 271 217 53 48
zma-miR166d-5p GGAAUGUUGUCUGGUUCAAGG 21 7,025 390 2,366 1    0 4 40 15 0 39 30 33 2 516 85 116 1 0 2,366 821 157 1,280 1,253 86 181
zma-miR166e UCGGACCAGGCUUCAUUCCC 20 148,793 7,085 134,052 1    170 124 155 1,631 408 211 709 1 1 10 5 7 2 14 10,342 134,052 362 271 217 53 48
zma-miR166f UCGGACCAGGCUUCAUUCCC 20 148,793 7,085 134,052 1    170 124 155 1,631 408 211 709 1 1 10 5 7 2 14 10,342 134,052 362 271 217 53 48
zma-miR166g-3p UCGGACCAGGCUUCAUUCCC 20 148,793 7,085 134,052 1    170 124 155 1,631 408 211 709 1 1 10 5 7 2 14 10,342 134,052 362 271 217 53 48
zma-miR166g-5p GGAAUGUUGUCUGGUUGGAGA 21 443 28 144 1    19 1 17 20 2 23 28 0 0 5 6 3 0 0 144 115 9 24 25 0 2
zma-miR166h-3p UCGGACCAGGCUUCAUUCCC 20 148,793 7,085 134,052 1    170 124 155 1,631 408 211 709 1 1 10 5 7 2 14 10,342 134,052 362 271 217 53 48
zma-miR166h-5p GGAAUGACGUCCGGUCCGAAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR166i-3p UCGGACCAGGCUUCAUUCCC 20 148,793 7,085 134,052 1    170 124 155 1,631 408 211 709 1 1 10 5 7 2 14 10,342 134,052 362 271 217 53 48
zma-miR166i-5p GGAAUGUCGUCUGGCGCGAGA 21 27 3 6 1    0 0 2 5 0 1 6 0 0 1 1 0 0 1 4 0 0 0 6 0 0
zma-miR166j-3p UCGGACCAGGCUUCAAUCCCU 21 91,733 4,587 26,637 1    2,421 7,283 4,552 12,148 3,365 22 0 44 1 5 9 74 510 1,628 19,999 26,637 3,691 3,969 3,697 763 915
zma-miR166j-5p GGUUUGUUUGUCUGGUUCAAGG 22 494 55 324 1    0 0 1 2 0 0 0 0 0 0 7 2 0 0 324 139 0 4 14 0 1
zma-miR166k-3p UCGGACCAGGCUUCAAUCCCU 21 91,733 4,587 26,637 1    2,421 7,283 4,552 12,148 3,365 22 0 44 1 5 9 74 510 1,628 19,999 26,637 3,691 3,969 3,697 763 915
zma-miR166k-5p GGAUUGUUGUCUGGCUCGGGG 21 160 13 40 1    0 4 2 6 0 0 0 1 0 0 0 3 1 0 28 24 1 40 34 0 16
zma-miR166l-3p UCGGACCAGGCUUCAUUCCUC 21 91,766 4,370 29,374 4    4,689 13,084 11,762 29,374 6,564 561 315 69 4 5 44 74 517 2,236 11,487 5,543 5,405 4 16 5 8
zma-miR166l-5p GAAUGGAGGCUGGUCCAAGA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR166m-3p UCGGACCAGGCUUCAUUCCUC 21 91,766 4,370 29,374 4    4,689 13,084 11,762 29,374 6,564 561 315 69 4 5 44 74 517 2,236 11,487 5,543 5,405 4 16 5 8
zma-miR166m-5p GGAAUGUUGGCUGGCUCGAGG 21 991 58 288 1    0 1 45 25 7 0 0 12 2 3 12 32 1 12 288 98 0 141 228 29 55
zma-miR166n-3p UCGGACCAGGCUUCAAUCCCU 21 91,733 4,587 26,637 1    2,421 7,283 4,552 12,148 3,365 22 0 44 1 5 9 74 510 1,628 19,999 26,637 3,691 3,969 3,697 763 915
zma-miR166n-5p GGAUUGUUGUCUGGCUCGGUG 21 1,226 72 300 1    0 3 36 33 12 0 0 9 0 1 3 21 1 1 255 219 62 202 300 5 63
zma-miR167a-3p GAUCAUGCAUGACAGCCUCAUU 22 18 2 5 1    0 0 1 1 1 0 0 0 0 1 0 0 0 0 1 0 0 4 5 0 4
zma-miR167a-5p UGAAGCUGCCAGCAUGAUCUA 21 95,805 4,562 23,385 56    1,860 2,313 5,309 23,385 2,572 18,199 18,273 5,504 450 2,575 3,785 8,864 56 148 109 212 1,482 266 248 82 113
zma-miR167b-3p GAUCAUGCUGUGACAGUUUCACU 23 70 10 32 1    0 0 0 0 0 18 12 1 0 32 1 0 0 0 0 5 0 0 0 0 1
zma-miR167b-5p UGAAGCUGCCAGCAUGAUCUA 21 95,805 4,562 23,385 56    1,860 2,313 5,309 23,385 2,572 18,199 18,273 5,504 450 2,575 3,785 8,864 56 148 109 212 1,482 266 248 82 113
zma-miR167c-3p GAUCAUGCUGUGGCAGCCUCACU 23 2,416 173 1,926 1    0 0 23 11 2 3 2 1 0 0 0 9 15 78 336 1,926 1 0 4 0 5
zma-miR167c-5p UGAAGCUGCCAGCAUGAUCUA 21 95,805 4,562 23,385 56    1,860 2,313 5,309 23,385 2,572 18,199 18,273 5,504 450 2,575 3,785 8,864 56 148 109 212 1,482 266 248 82 113
zma-miR167d-3p GGUCAUGCUGCUGCAGCCUCACU 23 375 31 301 1    0 0 2 1 0 4 2 2 0 0 1 3 4 10 37 301 8 0 0 0 0
zma-miR167d-5p UGAAGCUGCCAGCAUGAUCUA 21 95,805 4,562 23,385 56    1,860 2,313 5,309 23,385 2,572 18,199 18,273 5,504 450 2,575 3,785 8,864 56 148 109 212 1,482 266 248 82 113
zma-miR167e-3p GAUCAUGCUGUGCAGUUUCAUC 22 343 29 233 1    1 0 0 0 0 5 4 1 2 24 21 0 1 1 15 233 35 0 0 0 0
zma-miR167e-5p UGAAGCUGCCAGCAUGAUCUG 21 60,811 2,896 15,399 4    7,117 13 14 42 4 15,301 15,399 69 34 1,760 3,127 17 63 26 222 13,628 3,691 145 113 10 16
zma-miR167f-3p GAUCGUGCUGCGCAGUUUCACC 22 160 23 80 1    2 0 0 0 0 43 28 0 1 0 3 0 0 0 3 80 0 0 0 0 0
zma-miR167f-5p UGAAGCUGCCAGCAUGAUCUG 21 60,811 2,896 15,399 4    7,117 13 14 42 4 15,301 15,399 69 34 1,760 3,127 17 63 26 222 13,628 3,691 145 113 10 16
zma-miR167g-3p GGUCAUGCUGUAGUUUCAUC 20 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0
zma-miR167g-5p UGAAGCUGCCAGCAUGAUCUG 21 60,811 2,896 15,399 4    7,117 13 14 42 4 15,301 15,399 69 34 1,760 3,127 17 63 26 222 13,628 3,691 145 113 10 16
zma-miR167h-3p GAUCAUGUUGCAGCUUCAC 19 11 4 7 1    0 0 0 0 0 0 0 0 0 3 1 0 0 0 0 7 0 0 0 0 0
zma-miR167h-5p UGAAGCUGCCAGCAUGAUCUG 21 60,811 2,896 15,399 4    7,117 13 14 42 4 15,301 15,399 69 34 1,760 3,127 17 63 26 222 13,628 3,691 145 113 10 16
zma-miR167i-3p GAUCAUGUUGCAGCUUCAC 19 11 4 7 1    0 0 0 0 0 0 0 0 0 3 1 0 0 0 0 7 0 0 0 0 0
zma-miR167i-5p UGAAGCUGCCAGCAUGAUCUG 21 60,811 2,896 15,399 4    7,117 13 14 42 4 15,301 15,399 69 34 1,760 3,127 17 63 26 222 13,628 3,691 145 113 10 16
zma-miR167j-3p GAUCAUGUGGCAGUUUCAUU 20 2 1 1 1    0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0
zma-miR167j-5p UGAAGCUGCCAGCAUGAUCUG 21 60,811 2,896 15,399 4    7,117 13 14 42 4 15,301 15,399 69 34 1,760 3,127 17 63 26 222 13,628 3,691 145 113 10 16
zma-miR168a-3p CCCGCCUUGCACCAAGUGAA 20 321 27 124 1    0 0 0 0 0 1 2 0 9 4 3 0 0 0 67 124 33 52 14 5 7
zma-miR168a-5p UCGCUUGGUGCAGAUCGGGAC 21 1,623,558 77,312 768,052 97    31,239 4,144 23,651 73,202 14,519 138,809 124,326 3,058 5,457 20,540 13,696 2,762 97 321 18,876 335,176 768,052 16,906 17,015 2,532 9,180
zma-miR168b-3p CCCGCCUUGCAUCAAGUGAA 20 533 41 217 1    0 0 1 1 0 3 0 1 0 16 5 2 0 0 90 217 142 28 22 0 5
zma-miR168b-5p UCGCUUGGUGCAGAUCGGGAC 21 1,623,558 77,312 768,052 97    31,239 4,144 23,651 73,202 14,519 138,809 124,326 3,058 5,457 20,540 13,696 2,762 97 321 18,876 335,176 768,052 16,906 17,015 2,532 9,180
zma-miR169a-3p GGCAAGUUGUUCUUGGCUACA 21 9 2 4 1    0 0 0 2 0 1 0 0 0 0 1 0 1 0 0 0 4 0 0 0 0
zma-miR169a-5p CAGCCAAGGAUGACUUGCCGA 21 1,904 100 820 3    54 8 16 28 8 89 165 7 0 107 275 30 61 175 3 13 820 12 25 0 8
zma-miR169b-3p GGCAAGUUGUUCUUGGCUACA 21 9 2 4 1    0 0 0 2 0 1 0 0 0 0 1 0 1 0 0 0 4 0 0 0 0
zma-miR169b-5p CAGCCAAGGAUGACUUGCCGA 21 1,904 100 820 3    54 8 16 28 8 89 165 7 0 107 275 30 61 175 3 13 820 12 25 0 8
zma-miR169c-3p GGCAAGUCUGUCCUUGGCUACA 22 61 7 25 1    1 0 2 0 0 5 0 0 0 1 0 0 1 0 16 25 9 0 1 0 0
zma-miR169c-5p CAGCCAAGGAUGACUUGCCGG 21 32,489 1,805 18,865 1    367 3 34 10 0 1,301 4,200 234 13 6,613 18,865 330 61 98 11 34 313 0 1 0 1
zma-miR169d UAGCCAAGGAGACUGCCUAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169e UAGCCAAGGAGACUGCCUACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169f-3p GGCAUGUCUUCCUUGGCUACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169f-5p UAGCCAAGGAUGACUUGCCUA 21 1,911 119 1,551 1    2 0 1 3 2 53 42 19 1 150 1,551 23 4 1 8 45 6 0 0 0 0
zma-miR169g UAGCCAAGGAUGACUUGCCUA 21 1,911 119 1,551 1    2 0 1 3 2 53 42 19 1 150 1,551 23 4 1 8 45 6 0 0 0 0
zma-miR169h UAGCCAAGGAUGACUUGCCUA 21 1,911 119 1,551 1    2 0 1 3 2 53 42 19 1 150 1,551 23 4 1 8 45 6 0 0 0 0
zma-miR169i-3p GGCAGUCUCCUUGGCUAG 18 84 17 77 1    0 0 0 1 0 0 0 0 0 1 4 0 0 0 1 77 0 0 0 0 0
zma-miR169i-5p UAGCCAAGGAUGACUUGCCUG 21 1,742 109 675 1    29 0 1 10 4 185 110 4 8 675 331 28 46 24 47 223 17 0 0 0 0
zma-miR169j-3p GGCAGUCUCCUUGGCUAG 18 84 17 77 1    0 0 0 1 0 0 0 0 0 1 4 0 0 0 1 77 0 0 0 0 0
zma-miR169j-5p UAGCCAAGGAUGACUUGCCUG 21 1,742 109 675 1    29 0 1 10 4 185 110 4 8 675 331 28 46 24 47 223 17 0 0 0 0
zma-miR169k-3p GGCAGUCUCCUUGGCUAG 18 84 17 77 1    0 0 0 1 0 0 0 0 0 1 4 0 0 0 1 77 0 0 0 0 0
zma-miR169k-5p UAGCCAAGGAUGACUUGCCUG 21 1,742 109 675 1    29 0 1 10 4 185 110 4 8 675 331 28 46 24 47 223 17 0 0 0 0
zma-miR169l-3p GGCAAAUCAUCCCUGCUACC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169l-5p UAGCCAGGGAUGAUUUGCCUG 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
zma-miR169m-3p GGCAUCCAUUCUUGGCUAAG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169m-5p UAGCCAAGAAUGGCUUGCCUA 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
zma-miR169n-3p GGCAGGCCUUCUUGGCUAAG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169n-5p UAGCCAAGAAUGGCUUGCCUA 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
zma-miR169o-3p GGCAGGUCUUCUUGGCUAGC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169o-5p UAGCCAAGAAUGACUUGCCUA 21 9 2 3 1    0 0 0 1 0 0 0 0 1 3 1 0 0 0 0 0 3 0 0 0 0
zma-miR169p-3p GGCAAGUCAUCUGGGGCUACG 21 35 7 12 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 12 6 10 6
zma-miR169p-5p UAGCCAAGGAUGACUUGCCGG 21 4,333 228 1,147 1    0 127 52 122 46 4 2 588 64 67 138 645 244 650 0 1 1,147 166 154 43 73
zma-miR169q-3p GGCAGGCCUUCUGGCUAAG 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169q-5p UAGCCAAGAAUGGCUUGCCUA 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
zma-miR169r-3p GGCAAGUUGUCCUUGGCUACA 21 5 2 3 1    0 0 0 0 0 3 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0
zma-miR169r-5p CAGCCAAGGAUGACUUGCCGG 21 32,489 1,805 18,865 1    367 3 34 10 0 1,301 4,200 234 13 6,613 18,865 330 61 98 11 34 313 0 1 0 1
zma-miR171a-3p UGAUUGAGCCGCGCCAAUAU 20 3 1 1 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 1 0 0
zma-miR171a-5p UAUUGGCGAGGUUCAAUCAGA 21 16 3 7 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 1 0 4 7 0 2
zma-miR171b-3p UUGAGCCGUGCCAAUAUCAC 20 1,914 147 610 1    3 0 4 0 0 1 0 4 0 0 4 7 1 1 0 0 365 610 553 197 164
zma-miR171b-5p GAUAUUGGCGCGGUUCAAUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171c-3p UGACUGAGCCGUGCCAAUAUC 21 108 11 42 1    0 0 0 0 0 0 0 3 1 9 27 12 1 1 0 0 42 8 4 0 0
zma-miR171c-5p UAUUGGUGCGGUUCAAUCAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171d-3p UGAUUGAGCCGUGCCAAUAUC 21 94,621 4,506 46,602 39    703 222 383 106 39 522 912 4,156 1,108 5,054 20,756 8,646 273 189 717 1,667 46,602 1,050 1,037 197 282
zma-miR171d-5p UGUUGGCUCGGCUCACUCAGA 21 4,715 248 2,913 1    19 5 87 245 36 0 0 32 1 3 88 81 33 178 715 2,913 89 57 81 19 33
zma-miR171e-3p UGAUUGAGCCGUGCCAAUAUC 21 94,621 4,506 46,602 39    703 222 383 106 39 522 912 4,156 1,108 5,054 20,756 8,646 273 189 717 1,667 46,602 1,050 1,037 197 282
zma-miR171e-5p UGUUGGCUCGGCUCACUCAGA 21 4,715 248 2,913 1    19 5 87 245 36 0 0 32 1 3 88 81 33 178 715 2,913 89 57 81 19 33
zma-miR171f-3p UUGAGCCGUGCCAAUAUCACA 21 171 24 97 1    0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 16 97 29 19 8
zma-miR171f-5p CGAUGUUGGCAUGGCUCAAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171g-3p GAGGUGAGCCGAGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171g-5p UAUUGACUUGGCUCAUCUCUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171h-3p GUGAGCCGAACCAAUAUCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171h-5p UGGUAUUGUUUCGGCUCAUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171i-3p UGAUUGAGCCGUGCCAAUAUC 21 94,621 4,506 46,602 39    703 222 383 106 39 522 912 4,156 1,108 5,054 20,756 8,646 273 189 717 1,667 46,602 1,050 1,037 197 282
zma-miR171i-5p UGUUGGCACGGUUCAAUCAAA 21 167 24 69 1    0 0 0 0 0 12 16 0 69 16 1 0 0 0 0 2 51 0 0 0 0
zma-miR171j-3p UGAUUGAGCCGUGCCAAUAUC 21 94,621 4,506 46,602 39    703 222 383 106 39 522 912 4,156 1,108 5,054 20,756 8,646 273 189 717 1,667 46,602 1,050 1,037 197 282
zma-miR171j-5p UAUUGACGCGGUUCAAUUCGA 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0
zma-miR171k-3p GUGAGCCGAACCAAUAUCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171k-5p UGGUAUUGUUUCGGCUCAUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171l-3p GGAUUGAGCCGCGUCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171l-5p UAUUGGCGUGCCUCAAUCCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171m-3p GGAUUGAGCCGCGUCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171m-5p UAUUGGCGCGCCUCAAUCCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171n-3p UGAUUGAGCCGCGCCAAUAUC 21 216 18 72 1    0 0 0 0 0 0 2 9 5 11 64 25 2 1 0 1 72 0 19 5 0
zma-miR171n-5p UAUUGGUGAGGUUCAAUCCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR172a AGAAUCUUGAUGAUGCUGCA 20 141 8 42 1    12 5 7 42 11 7 14 1 1 0 0 1 13 6 3 9 4 0 4 0 1
zma-miR172b-3p AGAAUCUUGAUGAUGCUGCA 20 141 8 42 1    12 5 7 42 11 7 14 1 1 0 0 1 13 6 3 9 4 0 4 0 1
zma-miR172b-5p CAGCACCAUCAAGAUUCACA 20 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0
zma-miR172c-3p AGAAUCUUGAUGAUGCUGCA 20 141 8 42 1    12 5 7 42 11 7 14 1 1 0 0 1 13 6 3 9 4 0 4 0 1
zma-miR172c-5p CAGCACCACCAAGAUUCACA 20 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0
zma-miR172d-3p AGAAUCUUGAUGAUGCUGCA 20 141 8 42 1    12 5 7 42 11 7 14 1 1 0 0 1 13 6 3 9 4 0 4 0 1
zma-miR172d-5p CAGCACCAUCAAGAUUCACA 20 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0
zma-miR172e GGAAUCUUGAUGAUGCUGCAU 21 5,376 283 1,640 3    0 111 83 607 115 3 0 338 8 23 32 597 1,640 1,178 31 8 214 145 102 48 93
zma-miR2118a UUCCUGAUGCCUCUCAUUCCUA 22 65 7 38 1    0 1 2 38 8 0 0 0 0 0 0 0 0 1 6 3 0 4 2 0 0
zma-miR2118b UUCCCGAUGCCUCCCAUUCCUA 22 28 4 9 1    0 0 1 1 0 0 0 0 0 0 1 0 1 0 9 5 8 0 0 0 2
zma-miR2118c UUCCUAAUGCCUCCCAUUCCUA 22 9 2 3 1    0 0 2 1 2 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 1
zma-miR2118d UUCCUGAUGCCUCCCAUGCCUA 22 18 4 7 1    0 1 0 2 0 0 0 0 0 0 0 0 0 0 4 4 7 0 0 0 0
zma-miR2118e UUCCUGAUGUCUCCCAUUCCUA 22 4 1 2 1    0 0 1 2 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0
zma-miR2118f UUCCCAAUGCCUUCCAUGCCUA 22 2 1 1 1    0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0
zma-miR2118g UUCCUGAUGCCUCCUAUUCCUA 22 764 85 591 1    0 0 1 3 0 0 0 0 0 0 0 0 0 0 6 8 591 57 90 5 3
zma-miR2275a-3p UUUGUUUUCCUCCAAUAUCUCA 22 21 2 5 1    0 1 2 3 0 0 0 1 0 0 1 1 0 0 0 0 3 4 5 0 0
zma-miR2275a-5p AGAGUUGGAGGAAAGCAAACC 21 34 4 13 1    0 0 11 3 0 0 0 0 0 1 1 1 0 0 3 13 1 0 0 0 0
zma-miR2275b-3p UUCAGUUUCCUCUAAUAUCUCA 22 22 3 8 1    0 0 2 6 0 0 0 0 0 0 1 1 0 0 1 0 3 8 0 0 0
zma-miR2275b-5p AGGAUUAGAGGCAACUGAACC 21 55 8 21 1    0 0 14 1 0 0 0 0 0 1 1 1 0 0 16 21 0 0 0 0 0
zma-miR2275c-3p UUCAGUUUCCUCUAAUAUCUCA 22 22 3 8 1    0 0 2 6 0 0 0 0 0 0 1 1 0 0 1 0 3 8 0 0 0
zma-miR2275c-5p AGGAUUAGAGGGACUUGAACC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR2275d-3p UUUGUUUUCCUCUAAUAUCUCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR2275d-5p AGAGUUGGAGGAAAGAAAACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR319a-3p UUGGACUGAAGGGUGCUCCC 20 22,017 1,101 6,672 3    0 91 6 10 3 10 1,010 643 10 562 360 150 8 14 5,428 6,672 3,262 1,328 1,691 293 466
zma-miR319a-5p GAGCUCUCUUCAGUCCACUC 20 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
zma-miR319b-3p UUGGACUGAAGGGUGCUCCC 20 22,017 1,101 6,672 3    0 91 6 10 3 10 1,010 643 10 562 360 150 8 14 5,428 6,672 3,262 1,328 1,691 293 466
zma-miR319b-5p AGAGCGUCCUUCAGUCCACUC 21 5,485 305 3,537 1    0 6 1 11 2 0 0 297 11 593 77 9 12 12 212 461 3,537 93 129 5 17
zma-miR319c-3p UUGGACUGAAGGGUGCUCCC 20 22,017 1,101 6,672 3    0 91 6 10 3 10 1,010 643 10 562 360 150 8 14 5,428 6,672 3,262 1,328 1,691 293 466
zma-miR319c-5p GAGCUCUCUUCAGUCCACUC 20 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
zma-miR319d-3p UUGGACUGAAGGGUGCUCCC 20 22,017 1,101 6,672 3    0 91 6 10 3 10 1,010 643 10 562 360 150 8 14 5,428 6,672 3,262 1,328 1,691 293 466
zma-miR319d-5p AGAGCGUCCUUCAGUCCACUC 21 5,485 305 3,537 1    0 6 1 11 2 0 0 297 11 593 77 9 12 12 212 461 3,537 93 129 5 17
zma-miR390a-3p CGCUAUCUAUCCUGAGCUCCA 21 359 20 110 1    0 0 8 1 1 1 2 5 4 12 27 33 1 1 32 36 26 52 110 0 7
zma-miR390a-5p AAGCUCAGGAGGGAUAGCGCC 21 19,467 927 9,415 6    477 66 173 69 14 11 6 169 138 231 2,208 584 28 11 2,208 9,415 721 888 1,643 153 254
zma-miR390b-3p CGCUAUCUAUCCUGAGCUCCA 21 359 20 110 1    0 0 8 1 1 1 2 5 4 12 27 33 1 1 32 36 26 52 110 0 7
zma-miR390b-5p AAGCUCAGGAGGGAUAGCGCC 21 19,467 927 9,415 6    477 66 173 69 14 11 6 169 138 231 2,208 584 28 11 2,208 9,415 721 888 1,643 153 254
zma-miR393a-3p AUCAGUGCAAUCCCUUUGGAAU 22 3 2 2 1    0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0
zma-miR393a-5p UCCAAAGGGAUCGCAUUGAUCU 22 2,260 452 2,236 1    0 0 0 0 0 0 0 0 0 1 3 1 0 0 19 2,236 0 0 0 0 0
zma-miR393b-3p AUCAAUGCGAUCCUUUUGGAGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR393b-5p UCCAAAGGGAUCGCAUUGAUCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR393c-3p GUCAGUGCAAUCCCUUUGGAAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR393c-5p UCCAAAGGGAUCGCAUUGAUCU 22 2,260 452 2,236 1    0 0 0 0 0 0 0 0 0 1 3 1 0 0 19 2,236 0 0 0 0 0
zma-miR394a-3p AGGUGGGCAUACUGCCAAUG 20 33 3 16 1    0 0 0 1 2 0 0 1 0 0 1 1 1 1 1 2 0 16 6 0 0
zma-miR394a-5p UUGGCAUUCUGUCCACCUCC 20 10,335 492 4,209 1    139 147 155 22 27 65 100 6 1 9 4 43 4,209 2,431 679 779 1,210 137 92 14 66
zma-miR394b-3p AGGUGGGCAUACUGCCAAUG 20 33 3 16 1    0 0 0 1 2 0 0 1 0 0 1 1 1 1 1 2 0 16 6 0 0
zma-miR394b-5p UUGGCAUUCUGUCCACCUCC 20 10,335 492 4,209 1    139 147 155 22 27 65 100 6 1 9 4 43 4,209 2,431 679 779 1,210 137 92 14 66
zma-miR395a-3p GUGAAGUGUUUGGGGGAACUC 21 7 4 6 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 6 0 0 0 0 0
zma-miR395a-5p GUUCUCCUCAAACCACUUCAGUU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395b-3p GUGAAGUGUUUGGGGGAACUC 21 7 4 6 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 6 0 0 0 0 0
zma-miR395b-5p GUUCCCUACAAGCACUUCACAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395c-3p GUGAAGUGUUUGGAGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395c-5p GUUCCCUGCAAACACUUCACCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395d-3p GUGAAGUGUUUGGGGGAACUC 21 7 4 6 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 6 0 0 0 0 0
zma-miR395d-5p GUUCUAUGCAAGCACUUCACGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395e-3p GUGAAGUGUUUGGGGGAACUC 21 7 4 6 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 6 0 0 0 0 0
zma-miR395e-5p GUUCCCUUCAAGCACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395f-3p GUGAAGUGUUUGGGGGAACUC 21 7 4 6 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 6 0 0 0 0 0
zma-miR395f-5p GUUACCUACAAGCACGUCUCGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395g-3p GUGAAGUGUUUGGGGGAACUC 21 7 4 6 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 6 0 0 0 0 0
zma-miR395g-5p GUUCUAUGCAAGCACUUCACGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395h-3p GUGAAGUGUUUGGGGGAACUC 21 7 4 6 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 6 0 0 0 0 0
zma-miR395h-5p GUUCCCUUCAAGCACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395i-3p GUGAAGUGUUUGGGGGAACUC 21 7 4 6 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 6 0 0 0 0 0
zma-miR395i-5p GUUCCCUACAAGCACUUCACGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395j-3p GUGAAGUGUUUGGGGGAACUC 21 7 4 6 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 6 0 0 0 0 0
zma-miR395j-5p GUUCCCUUCAAGCACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395k-3p GUGAAGUGUUUGAGGAAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395k-5p GUUUCCUUCAAGCACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395l-3p GUGAAGUGUUUGGAGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395l-5p GUUCCUUCCAAACACUUCACCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395m-3p GUGAAGUGUUUGGAGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395m-5p GUUCCUUUCAAACACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395n-3p GUGAAGUGUUUGGGGGAACUC 21 7 4 6 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 6 0 0 0 0 0
zma-miR395n-5p GUUCUCUACAAGCACUUCACGA 22 1 1 1 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0
zma-miR395o-3p GUGAAGUGUUUGGGUGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395o-5p GUUCUCUUCAAGCACUUCACGA 22 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0
zma-miR395p-3p GUGAAGUGUUUGGGGGAACUC 21 7 4 6 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 6 0 0 0 0 0
zma-miR395p-5p GUUCCCUUCAAGCACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR396a-3p GUUCAAUAAAGCUGUGGGAAA 21 1,849 103 406 1    66 0 11 13 2 24 28 5 406 235 181 15 1 0 38 130 204 89 294 0 107
zma-miR396a-5p UUCCACAGCUUUCUUGAACUG 21 4,156 198 951 4    218 23 25 50 9 125 671 4 32 26 45 7 15 11 951 256 183 577 593 110 225
zma-miR396b-3p GUUCAAUAAAGCUGUGGGAAA 21 1,849 103 406 1    66 0 11 13 2 24 28 5 406 235 181 15 1 0 38 130 204 89 294 0 107
zma-miR396b-5p UUCCACAGCUUUCUUGAACUG 21 4,156 198 951 4    218 23 25 50 9 125 671 4 32 26 45 7 15 11 951 256 183 577 593 110 225
zma-miR396c UUCCACAGGCUUUCUUGAACUG 22 9 2 3 1    0 0 0 0 0 1 2 0 0 0 1 0 0 0 3 2 0 0 0 0 0
zma-miR396d UUCCACAGGCUUUCUUGAACUG 22 9 2 3 1    0 0 0 0 0 1 2 0 0 0 1 0 0 0 3 2 0 0 0 0 0
zma-miR396e-3p GGUCAAGAAAGCCGUGGGAAG 21 2 1 1 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0
zma-miR396e-5p UUCCACAGCUUUCUUGAACUU 21 17,167 1,010 13,415 1    236 1 6 0 0 93 179 10 2 3 575 34 1 0 2,530 13,415 47 24 8 0 3
zma-miR396f-3p GGUCAAGAAAGCUGUGGGAAG 21 1,105 85 525 2    116 0 16 2 0 0 2 9 0 3 525 26 0 0 138 154 91 0 20 0 3
zma-miR396f-5p UUCCACAGCUUUCUUGAACUU 21 17,167 1,010 13,415 1    236 1 6 0 0 93 179 10 2 3 575 34 1 0 2,530 13,415 47 24 8 0 3
zma-miR396g-3p GUUCAAGAAAGCUGUGGAAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR396g-5p UCCCACAGCUUUAUUGAACUG 21 5 3 3 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 2 0 0 0 0 0
zma-miR396h UCCCACAGCUUUAUUGAACUG 21 5 3 3 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 2 0 0 0 0 0
zma-miR397a-3p UAGCCGUUAGCGCUCAUUAACU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR397a-5p UCAUUGAGCGCAGCGUUGAUG 21 35 4 13 1    1 0 0 1 1 0 2 1 7 7 13 2 0 0 0 0 0 0 0 0 0
zma-miR397b-3p CCAGCGCUGCACUCAAUUACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR397b-5p UCAUUGAGCGCAGCGUUGAUG 21 35 4 13 1    1 0 0 1 1 0 2 1 7 7 13 2 0 0 0 0 0 0 0 0 0
zma-miR398a-3p UGUGUUCUCAGGUCGCCCCCG 21 662 35 129 1    3 0 2 1 1 2 129 1 16 49 107 33 0 1 62 24 2 109 70 24 26
zma-miR398a-5p GGGGCGAACUGAGAACACAUG 21 20 3 5 1    0 0 0 0 0 0 0 0 1 3 5 1 0 0 3 3 0 4 0 0 0
zma-miR398b-3p UGUGUUCUCAGGUCGCCCCCG 21 662 35 129 1    3 0 2 1 1 2 129 1 16 49 107 33 0 1 62 24 2 109 70 24 26
zma-miR398b-5p GGGGCGGACUGGGAACACAUG 21 190 19 64 1    0 0 2 0 0 0 0 1 4 32 31 6 0 0 64 44 0 4 0 0 2
zma-miR399a-3p UGCCAAAGGAGAAUUGCCCUG 21 516 34 237 1    237 0 0 2 0 1 0 3 0 112 54 2 1 0 2 1 71 12 10 5 3
zma-miR399a-5p GUGCGGUUCUCCUCUGGCACG 21 5 3 4 1    4 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
zma-miR399b-3p UGCCAAAGGAGAGCUGUCCUG 21 164 33 143 1    143 0 0 0 0 0 0 0 1 2 1 0 0 0 0 0 17 0 0 0 0
zma-miR399b-5p GUGCAGCUCUCCUCUGGCAUG 21 509 509 509 509    509 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR399c-3p UGCCAAAGGAGAAUUGCCCUG 21 516 34 237 1    237 0 0 2 0 1 0 3 0 112 54 2 1 0 2 1 71 12 10 5 3
zma-miR399c-5p GGGUACGUCUCCUUUGGCACA 21 97 12 39 1    39 0 0 3 0 0 0 0 0 0 0 0 0 1 0 0 6 12 29 5 2
zma-miR399d-3p UGCCAAAGGAGAGCUGCCCUG 21 57 11 50 1    50 0 0 0 0 0 0 1 3 0 1 0 0 0 0 0 2 0 0 0 0
zma-miR399d-5p GUGUGGCUCUCCUCUGGCAUG 21 286 57 269 1    269 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 4 11 0 0
zma-miR399e-3p UGCCAAAGGAGAGUUGCCCUG 21 1,087 54 541 1    241 0 2 5 2 1 18 13 1 23 46 6 1 1 35 6 541 48 72 10 15
zma-miR399e-5p GGGCUUCUCUUUCUUGGCAGG 21 427 36 235 1    13 0 0 0 0 2 2 1 0 1 0 0 0 0 1 1 3 137 235 5 26
zma-miR399f-3p UGCCAAAGGAAAUUUGCCCCG 21 66 7 22 1    19 0 0 0 0 0 0 1 1 0 13 0 0 0 1 2 22 4 1 0 2
zma-miR399f-5p GGGCAACUUCUCCUUUGGCAGA 22 406 68 196 1    30 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 153 196 10 16
zma-miR399g-3p UGCCAAAGGGGAUUUGCCCGG 21 161 23 137 1    6 0 0 0 0 1 0 1 1 13 137 0 0 0 0 0 2 0 0 0 0
zma-miR399g-5p GGGCAACCCCCCGUUGGCAGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR399h-3p UGCCAAAGGAGAAUUGCCCUG 21 516 34 237 1    237 0 0 2 0 1 0 3 0 112 54 2 1 0 2 1 71 12 10 5 3
zma-miR399h-5p GUGCAGUUCUCCUCUGGCACG 21 10 3 8 1    8 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0
zma-miR399i-3p UGCCAAAGGAGAGUUGCCCUG 21 1,087 54 541 1    241 0 2 5 2 1 18 13 1 23 46 6 1 1 35 6 541 48 72 10 15
zma-miR399i-5p GUGCGGCUCUCCUCUGGCAUG 21 1 1 1 1    1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR399j-3p UGCCAAAGGAGAGUUGCCCUG 21 1,087 54 541 1    241 0 2 5 2 1 18 13 1 23 46 6 1 1 35 6 541 48 72 10 15
zma-miR399j-5p AGGCAGCUCUCCUCUGGCAGG 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0
zma-miR408a CUGCACUGCCUCUUCCCUGGC 21 5,892 310 2,516 1    56 0 8 5 1 64 966 0 6 63 30 8 1 1 97 414 32 2,516 1,149 254 221
zma-miR408b-3p CUGCACUGCCUCUUCCCUGGC 21 5,892 310 2,516 1    56 0 8 5 1 64 966 0 6 63 30 8 1 1 97 414 32 2,516 1,149 254 221
zma-miR408b-5p CAGGGACGAGGCAGAGCAUGG 21 21 3 8 1    1 0 1 0 0 0 0 0 1 4 3 1 0 0 2 8 0 0 0 0 0
zma-miR444a UGCAGUUGUUGUCUCAAGCUU 21 6,499 309 1,026 10    907 193 165 482 56 633 747 73 129 498 498 45 99 32 1,026 796 55 16 23 10 16
zma-miR444b UGCAGUUGUUGUCUCAAGCUU 21 6,499 309 1,026 10    907 193 165 482 56 633 747 73 129 498 498 45 99 32 1,026 796 55 16 23 10 16
zma-miR482-3p UCUUCCUUGUUCCUCCCAUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR482-5p UGGGAGAUGAAGGAGCCUU 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR528a-3p CCUGUGCCUGCCUCUUCCAUU 21 171 21 70 1    0 0 0 0 1 0 0 0 0 0 0 0 0 0 32 70 6 12 33 5 12
zma-miR528a-5p UGGAAGGGGCAUGCAGAGGAG 21 9,609 480 3,903 1    1,928 9 826 821 65 120 319 9 28 174 146 348 1 0 151 36 3,903 218 342 38 127
zma-miR528b-3p CCUGUGCCUGCCUCUUCCAUU 21 171 21 70 1    0 0 0 0 1 0 0 0 0 0 0 0 0 0 32 70 6 12 33 5 12
zma-miR528b-5p UGGAAGGGGCAUGCAGAGGAG 21 9,609 480 3,903 1    1,928 9 826 821 65 120 319 9 28 174 146 348 1 0 151 36 3,903 218 342 38 127
zma-miR529-3p GCUGUACCCUCUCUCUUCUUC 21 702 44 225 1    0 0 12 38 191 0 0 1 2 7 1 121 1 0 9 225 74 12 2 5 1
zma-miR529-5p AGAAGAGAGAGAGUACAGCCU 21 57,653 3,034 19,664 1    0 4 1,914 637 1,456 1 2 70 227 854 471 17,486 2 0 4,392 9,968 19,664 258 104 125 18
zma-miR827-3p UUAGAUGACCAUCAGCAAACA 21 54,963 2,748 28,229 4    7,699 560 341 138 46 6,627 5,566 271 40 628 768 369 4 0 403 348 28,229 997 1,135 355 439
zma-miR827-5p UUUGUUGGUGGUCAUUUAACC 21 2,096 131 1,778 2    69 2 2 12 0 21 34 0 0 5 6 3 0 0 8 20 1,778 52 65 14 5