Maize Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the miRBase registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  Zma1Zma2Zma3Smop1SwtMzSeShootsMzSeRootsMzEarMzPollenMzRootsMzSeedlingsMzTasselht_rmr2_1ho_rmr2_1Ear1_ControlEar2_ControlEar1_mop1Ear2_mop1Out_ear_UnfrtWT_h1_rp1hen1_rp10_3mmAnt10_3mmAnt2ant_0_2_2ant_0_2_3
zma-miR11969-3p UUAUACCCAUCUCUCACCUUGCAA 24 8 0 4 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 3
zma-miR11969-5p GCAAGGUCAGAGAAGGAUAUAAUC 24 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1
zma-miR11970-3p UGGUUUGGUUGCACGUUUGCA 21 95 4 20 1    1 1 0 3 1 2 12 1 1 20 14 7 0 0 0 0 8 0 0 2 1 0 5 7 9
zma-miR11970-5p CAAGCGUGCAAGCAAACCAUU 21 15 1 4 1    0 0 0 0 0 1 0 1 3 4 1 2 1 0 0 1 0 0 1 0 0 0 0 0 0
zma-miR1432-3p GGGUGUCAUCUCGCCUGAAGCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR1432-5p CUCAGGAGAGAUGACACCGAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR156a-3p GCUCACUUCUCUCUCUGUCAGU 22 208 8 104 3    0 0 0 0 0 10 4 0 3 70 104 0 0 0 0 0 0 0 0 3 14 0 0 0 0
zma-miR156a-5p UGACAGAAGAGAGUGAGCAC 20 861,633 34,465 348,904 10    136,358 144 412 657 79 348,904 277,825 237 995 7,657 16,875 153 1,985 621 10 12 192 186 5,059 1,008 61,835 195 163 40 31
zma-miR156b-3p GCUCACCCUCUAUCUGUCAGU 21 3,636 145 1,181 10    0 0 0 0 0 221 448 0 30 876 68 10 0 0 19 48 573 1,181 0 14 148 0 0 0 0
zma-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 861,633 34,465 348,904 10    136,358 144 412 657 79 348,904 277,825 237 995 7,657 16,875 153 1,985 621 10 12 192 186 5,059 1,008 61,835 195 163 40 31
zma-miR156c UGACAGAAGAGAGUGAGCAC 20 861,633 34,465 348,904 10    136,358 144 412 657 79 348,904 277,825 237 995 7,657 16,875 153 1,985 621 10 12 192 186 5,059 1,008 61,835 195 163 40 31
zma-miR156d-3p GCUCACUUCUCUUUCUGUCAGC 22 7,676 307 5,900 1    29 0 2 2 1 137 723 1 1 122 206 1 42 171 0 0 0 0 138 195 5,900 0 0 2 3
zma-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 861,633 34,465 348,904 10    136,358 144 412 657 79 348,904 277,825 237 995 7,657 16,875 153 1,985 621 10 12 192 186 5,059 1,008 61,835 195 163 40 31
zma-miR156e-3p GCUCACUGCUCUCUCUGUCAUC 22 502 20 438 1    2 0 0 0 0 1 0 1 1 15 25 0 0 0 0 0 0 0 0 19 438 0 0 0 0
zma-miR156e-5p UGACAGAAGAGAGUGAGCAC 20 861,633 34,465 348,904 10    136,358 144 412 657 79 348,904 277,825 237 995 7,657 16,875 153 1,985 621 10 12 192 186 5,059 1,008 61,835 195 163 40 31
zma-miR156f-3p GCUCACUUCUCUUUCUGUCAGC 22 7,676 307 5,900 1    29 0 2 2 1 137 723 1 1 122 206 1 42 171 0 0 0 0 138 195 5,900 0 0 2 3
zma-miR156f-5p UGACAGAAGAGAGUGAGCAC 20 861,633 34,465 348,904 10    136,358 144 412 657 79 348,904 277,825 237 995 7,657 16,875 153 1,985 621 10 12 192 186 5,059 1,008 61,835 195 163 40 31
zma-miR156g-3p GCUCACUUCUCUUUCUGUCAGC 22 7,676 307 5,900 1    29 0 2 2 1 137 723 1 1 122 206 1 42 171 0 0 0 0 138 195 5,900 0 0 2 3
zma-miR156g-5p UGACAGAAGAGAGUGAGCAC 20 861,633 34,465 348,904 10    136,358 144 412 657 79 348,904 277,825 237 995 7,657 16,875 153 1,985 621 10 12 192 186 5,059 1,008 61,835 195 163 40 31
zma-miR156h-3p GCUCACUGCUCUUUCUGUCAUC 22 205 8 70 1    0 0 0 1 0 21 6 0 10 69 5 1 2 10 0 0 0 0 2 8 70 0 0 0 0
zma-miR156h-5p UGACAGAAGAGAGUGAGCAC 20 861,633 34,465 348,904 10    136,358 144 412 657 79 348,904 277,825 237 995 7,657 16,875 153 1,985 621 10 12 192 186 5,059 1,008 61,835 195 163 40 31
zma-miR156i-3p GCUCACUGCUCUAUCUGUCAUC 22 280 11 84 1    0 0 0 2 0 24 12 0 59 4 16 1 46 4 0 0 0 0 0 26 84 0 0 0 2
zma-miR156i-5p UGACAGAAGAGAGUGAGCAC 20 861,633 34,465 348,904 10    136,358 144 412 657 79 348,904 277,825 237 995 7,657 16,875 153 1,985 621 10 12 192 186 5,059 1,008 61,835 195 163 40 31
zma-miR156j-3p UGCUCUCUGCUCUCACUGUCAUC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR156j-5p UGACAGAAGAGAGAGAGCACA 21 18 1 11 1    0 0 0 0 0 0 4 0 0 1 0 0 0 0 0 0 0 0 11 0 2 0 0 0 0
zma-miR156k-3p GCUCGCUUCUCUUUCUGUCAGC 22 760 30 407 1    1 0 0 1 0 12 254 0 0 17 17 0 3 8 0 0 0 0 6 34 407 0 0 0 0
zma-miR156k-5p UGACAGAAGAGAGCGAGCAC 20 28,302 1,132 12,652 1    2,426 8 12 21 1 12,652 10,185 11 4 181 439 6 218 65 5 2 0 10 220 67 1,718 7 22 13 9
zma-miR156l-3p GCUCACUGCUCUAUCUGUCACC 22 976 39 376 1    0 0 1 6 0 149 270 1 3 10 29 1 36 51 0 0 0 5 5 32 376 0 0 0 1
zma-miR156l-5p UGACAGAAGAGAGUGAGCAC 20 861,633 34,465 348,904 10    136,358 144 412 657 79 348,904 277,825 237 995 7,657 16,875 153 1,985 621 10 12 192 186 5,059 1,008 61,835 195 163 40 31
zma-miR159a-3p UUUGGAUUGAAGGGAGCUCUG 21 260,680 10,427 61,089 134    882 180 160 325 134 2,121 15,258 3,135 1,158 9,018 18,517 6,153 1,395 1,948 2,877 3,835 10,249 11,515 61,089 11,530 13,506 21,711 57,434 4,872 1,678
zma-miR159a-5p GAGCUCCUAUCAUUCCAAUGA 21 4,466 179 2,429 1    2 1 1 0 0 2 4 3 0 6 14 5 0 0 72 90 86 125 2 1,505 2,429 35 17 53 14
zma-miR159b-3p UUUGGAUUGAAGGGAGCUCUG 21 260,680 10,427 61,089 134    882 180 160 325 134 2,121 15,258 3,135 1,158 9,018 18,517 6,153 1,395 1,948 2,877 3,835 10,249 11,515 61,089 11,530 13,506 21,711 57,434 4,872 1,678
zma-miR159b-5p GUGCUCCCUUCAAACCAAUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159c-3p CUUGGAUUGAAGGGAGCUCCU 21 217 9 133 1    0 0 0 0 0 0 133 0 0 0 0 0 0 0 5 2 12 21 31 4 1 0 0 5 3
zma-miR159c-5p GAGCUCCCUUCGAUCCAAUCC 21 22 1 11 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 8 11 0 1 0 0 0 0 0
zma-miR159d-3p CUUGGAUUGAAGGGAGCUCCU 21 217 9 133 1    0 0 0 0 0 0 133 0 0 0 0 0 0 0 5 2 12 21 31 4 1 0 0 5 3
zma-miR159d-5p GAGCUCCCUUCGAUCCAAUCC 21 22 1 11 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 8 11 0 1 0 0 0 0 0
zma-miR159e-3p AUUGGUUUGAAGGGAGCUCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159e-5p CAGCUCCUGCAGCAUCUGUUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159f-3p UUUGGAUUGAAGGGAGCUCUG 21 260,680 10,427 61,089 134    882 180 160 325 134 2,121 15,258 3,135 1,158 9,018 18,517 6,153 1,395 1,948 2,877 3,835 10,249 11,515 61,089 11,530 13,506 21,711 57,434 4,872 1,678
zma-miR159f-5p GAGCUCCUCUCAUUCCAAUGA 21 84 3 53 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 18 1 53 9 0 0 1 1
zma-miR159g-3p UUUGGAGUGAAGGGAGUUCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159g-5p GUGCUCCCUUCACACCAAUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159h-3p UUUGGAGUGAAGGGAGCUCUG 21 423 17 207 1    0 0 0 0 0 0 0 2 207 6 18 10 2 2 0 2 8 9 1 1 1 41 110 2 1
zma-miR159h-5p GUGCUCCCUUCACACCAAUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159i-3p UUUGGAGUGAAGGGAGCUCUG 21 423 17 207 1    0 0 0 0 0 0 0 2 207 6 18 10 2 2 0 2 8 9 1 1 1 41 110 2 1
zma-miR159i-5p GUGCUCCCUUCACACCAAUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159j-3p UUUGGAUUGAAGGGAGCUCUG 21 260,680 10,427 61,089 134    882 180 160 325 134 2,121 15,258 3,135 1,158 9,018 18,517 6,153 1,395 1,948 2,877 3,835 10,249 11,515 61,089 11,530 13,506 21,711 57,434 4,872 1,678
zma-miR159j-5p GUGCUCCCUUCAAACCAAUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159k-3p UUUGGAUUGAAGGGAGCUCUG 21 260,680 10,427 61,089 134    882 180 160 325 134 2,121 15,258 3,135 1,158 9,018 18,517 6,153 1,395 1,948 2,877 3,835 10,249 11,515 61,089 11,530 13,506 21,711 57,434 4,872 1,678
zma-miR159k-5p GUGCUCCCUUCAAACCAAUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR160a-3p GCGUGCAAGGGGCCAAGCAUG 21 182 7 89 1    0 0 0 0 0 18 4 0 0 89 9 1 1 0 0 7 20 26 0 1 6 0 0 0 0
zma-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 9,284 371 3,536 1    332 123 72 81 125 429 356 5 1 11 12 30 84 735 5 11 41 91 3,536 750 336 61 73 1,206 778
zma-miR160b-3p GCGUGCAAGGAGCCAAGCAUG 21 6,967 279 2,027 2    52 5 25 12 19 106 76 197 16 402 384 115 82 114 399 771 1,799 2,027 10 49 269 2 12 13 11
zma-miR160b-5p UGCCUGGCUCCCUGUAUGCCA 21 9,284 371 3,536 1    332 123 72 81 125 429 356 5 1 11 12 30 84 735 5 11 41 91 3,536 750 336 61 73 1,206 778
zma-miR160c-3p GCGUGCAUGGUGCCAAGCAUA 21 84 3 25 1    0 0 0 1 0 0 0 0 0 0 0 1 0 4 0 7 25 23 0 10 13 0 0 0 0
zma-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 9,284 371 3,536 1    332 123 72 81 125 429 356 5 1 11 12 30 84 735 5 11 41 91 3,536 750 336 61 73 1,206 778
zma-miR160d-3p GCGUGCGUGGAGCCAAGCAUG 21 95 4 29 1    0 1 2 1 0 0 2 2 0 1 1 3 0 28 10 5 29 7 0 0 1 0 0 0 2
zma-miR160d-5p UGCCUGGCUCCCUGUAUGCCA 21 9,284 371 3,536 1    332 123 72 81 125 429 356 5 1 11 12 30 84 735 5 11 41 91 3,536 750 336 61 73 1,206 778
zma-miR160e UGCCUGGCUCCCUGUAUGCCA 21 9,284 371 3,536 1    332 123 72 81 125 429 356 5 1 11 12 30 84 735 5 11 41 91 3,536 750 336 61 73 1,206 778
zma-miR160f-3p GCGUGCGAGGUGCCAGGCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR160f-5p UGCCUGGCUCCCUGUAUGCCG 21 96 4 57 1    0 0 0 0 0 1 0 0 0 0 0 0 0 0 10 3 57 0 7 1 0 0 2 7 8
zma-miR160g-3p GCGUGCAAGGAGCCAAGCAUG 21 6,967 279 2,027 2    52 5 25 12 19 106 76 197 16 402 384 115 82 114 399 771 1,799 2,027 10 49 269 2 12 13 11
zma-miR160g-5p UGCCUGGCUCCCUGUAUGCCA 21 9,284 371 3,536 1    332 123 72 81 125 429 356 5 1 11 12 30 84 735 5 11 41 91 3,536 750 336 61 73 1,206 778
zma-miR162-3p UCGAUAAACCUCUGCAUCCA 20 293 12 240 1    0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 4 1 0 21 240 2 10 9 5
zma-miR162-5p GGGCGCAGUGGUUUAUCGAUC 21 55 2 14 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 0 14 0 12 13 7 0 4 2
zma-miR164a-3p CACGUGUUCUCCUUCUCCAUC 21 288 12 78 1    0 0 0 0 1 0 0 4 0 1 1 6 0 0 10 77 78 72 1 3 34 0 0 0 0
zma-miR164a-5p UGGAGAAGCAGGGCACGUGCA 21 34,294 1,372 21,084 14    1,152 208 162 32 14 2,499 1,971 371 23 1,340 2,768 475 374 715 19 62 159 280 21,084 288 85 46 68 66 33
zma-miR164b-3p AUGUGCCCAUCUUCUCCACC 20 37 1 21 1    0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 21 13 0 0 0 0
zma-miR164b-5p UGGAGAAGCAGGGCACGUGCA 21 34,294 1,372 21,084 14    1,152 208 162 32 14 2,499 1,971 371 23 1,340 2,768 475 374 715 19 62 159 280 21,084 288 85 46 68 66 33
zma-miR164c-3p CAUGUGCCCUUCUUCUCCAUC 21 902 36 533 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 30 78 107 64 89 533 0 0 0 0
zma-miR164c-5p UGGAGAAGCAGGGCACGUGCA 21 34,294 1,372 21,084 14    1,152 208 162 32 14 2,499 1,971 371 23 1,340 2,768 475 374 715 19 62 159 280 21,084 288 85 46 68 66 33
zma-miR164d-3p CACGUGGUCUCCUUCUCCAU 20 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
zma-miR164d-5p UGGAGAAGCAGGGCACGUGCA 21 34,294 1,372 21,084 14    1,152 208 162 32 14 2,499 1,971 371 23 1,340 2,768 475 374 715 19 62 159 280 21,084 288 85 46 68 66 33
zma-miR164e-3p CAUGUGUCCGCCCUCUCCACC 21 2 0 2 2    0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR164e-5p UGGAGAAGCAGGACACGUGAG 21 4,182 167 2,347 1    2,347 5 2 5 0 837 622 0 1 159 60 1 9 2 0 0 4 30 98 0 0 0 0 0 0
zma-miR164f-3p CACGUGCGCUCCUUCUCCAAC 21 1 0 1 1    0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR164f-5p UGGAGAAGCAGGGCACGUGCU 21 805 32 378 1    19 2 3 0 0 126 160 4 14 378 78 2 2 2 0 0 0 1 10 1 3 0 0 0 0
zma-miR164g-3p CACGUGCUCCCCUUCUCCACC 21 1,028 41 229 1    0 0 0 0 0 0 0 0 0 0 1 1 1 0 5 95 102 143 2 152 229 50 24 110 113
zma-miR164g-5p UGGAGAAGCAGGGCACGUGCA 21 34,294 1,372 21,084 14    1,152 208 162 32 14 2,499 1,971 371 23 1,340 2,768 475 374 715 19 62 159 280 21,084 288 85 46 68 66 33
zma-miR164h-3p CAUGUGCCCUUCUUCUCCAUC 21 902 36 533 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 30 78 107 64 89 533 0 0 0 0
zma-miR164h-5p UGGAGAAGCAGGGCACGUGUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 2,349,261 93,970 734,864 96    23,147 17,223 22,635 67,356 17,426 23,750 43,473 144 96 634 288 150 10,438 84,182 284 893 1,292 2,136 14,617 734,864 386,330 114,090 115,978 415,559 252,276
zma-miR166a-5p GGAAUGUUGUCUGGCUCGGGG 21 420 17 79 1    2 1 8 14 2 11 14 2 0 6 1 2 2 0 0 15 29 79 13 74 62 26 0 23 34
zma-miR166b-3p UCGGACCAGGCUUCAUUCCC 20 171,883 6,875 152,294 1    174 125 155 1,643 408 215 729 1 1 11 5 7 17 140 53 48 274 222 182 10,590 152,294 675 715 1,882 1,317
zma-miR166b-5p GGAAUGUUGUCUGGUUCAAGG 21 9,713 389 2,423 2    0 4 40 16 0 40 31 33 2 530 87 118 4 0 87 182 1,296 1,283 79 2,423 933 313 442 1,088 682
zma-miR166c-3p UCGGACCAGGCUUCAUUCCC 20 171,883 6,875 152,294 1    174 125 155 1,643 408 215 729 1 1 11 5 7 17 140 53 48 274 222 182 10,590 152,294 675 715 1,882 1,317
zma-miR166c-5p GGAAUGUUGUCUGGCUCGAGG 21 1,614 65 354 4    19 20 30 11 4 32 76 15 18 85 12 11 45 65 38 113 311 354 30 164 117 17 7 8 12
zma-miR166d-3p UCGGACCAGGCUUCAUUCCC 20 171,883 6,875 152,294 1    174 125 155 1,643 408 215 729 1 1 11 5 7 17 140 53 48 274 222 182 10,590 152,294 675 715 1,882 1,317
zma-miR166d-5p GGAAUGUUGUCUGGUUCAAGG 21 9,713 389 2,423 2    0 4 40 16 0 40 31 33 2 530 87 118 4 0 87 182 1,296 1,283 79 2,423 933 313 442 1,088 682
zma-miR166e UCGGACCAGGCUUCAUUCCC 20 171,883 6,875 152,294 1    174 125 155 1,643 408 215 729 1 1 11 5 7 17 140 53 48 274 222 182 10,590 152,294 675 715 1,882 1,317
zma-miR166f UCGGACCAGGCUUCAUUCCC 20 171,883 6,875 152,294 1    174 125 155 1,643 408 215 729 1 1 11 5 7 17 140 53 48 274 222 182 10,590 152,294 675 715 1,882 1,317
zma-miR166g-3p UCGGACCAGGCUUCAUUCCC 20 171,883 6,875 152,294 1    174 125 155 1,643 408 215 729 1 1 11 5 7 17 140 53 48 274 222 182 10,590 152,294 675 715 1,882 1,317
zma-miR166g-5p GGAAUGUUGUCUGGUUGGAGA 21 467 19 148 1    19 1 17 20 2 23 29 0 0 5 6 3 0 0 0 2 25 26 4 148 130 0 0 7 0
zma-miR166h-3p UCGGACCAGGCUUCAUUCCC 20 171,883 6,875 152,294 1    174 125 155 1,643 408 215 729 1 1 11 5 7 17 140 53 48 274 222 182 10,590 152,294 675 715 1,882 1,317
zma-miR166h-5p GGAAUGACGUCCGGUCCGAAC 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
zma-miR166i-3p UCGGACCAGGCUUCAUUCCC 20 171,883 6,875 152,294 1    174 125 155 1,643 408 215 729 1 1 11 5 7 17 140 53 48 274 222 182 10,590 152,294 675 715 1,882 1,317
zma-miR166i-5p GGAAUGUCGUCUGGCGCGAGA 21 37 1 10 1    0 0 2 5 0 1 6 0 0 1 1 0 0 10 0 0 0 6 0 5 0 0 0 0 0
zma-miR166j-3p UCGGACCAGGCUUCAAUCCCU 21 249,551 9,982 51,440 1    2,479 7,329 4,569 12,235 3,370 22 0 44 1 5 9 75 5,110 16,448 765 919 4,020 3,785 1,851 20,479 30,262 45,324 51,440 26,669 12,341
zma-miR166j-5p GGUUUGUUUGUCUGGUUCAAGG 22 706 28 332 1    0 0 1 2 0 0 0 0 0 0 7 2 0 0 0 1 4 15 0 332 158 43 37 60 44
zma-miR166k-3p UCGGACCAGGCUUCAAUCCCU 21 249,551 9,982 51,440 1    2,479 7,329 4,569 12,235 3,370 22 0 44 1 5 9 75 5,110 16,448 765 919 4,020 3,785 1,851 20,479 30,262 45,324 51,440 26,669 12,341
zma-miR166k-5p GGAUUGUUGUCUGGCUCGGGG 21 1,358 54 422 1    0 4 2 6 0 0 0 1 0 0 0 3 1 0 0 16 41 35 1 29 27 226 242 422 302
zma-miR166l-3p UCGGACCAGGCUUCAUUCCUC 21 203,297 8,132 29,585 4    4,802 13,166 11,806 29,585 6,573 571 323 69 4 5 44 75 5,176 22,596 5 8 4 16 2,711 11,762 6,297 25,254 23,754 26,851 11,840
zma-miR166l-5p GAAUGGAGGCUGGUCCAAGA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR166m-3p UCGGACCAGGCUUCAUUCCUC 21 203,297 8,132 29,585 4    4,802 13,166 11,806 29,585 6,573 571 323 69 4 5 44 75 5,176 22,596 5 8 4 16 2,711 11,762 6,297 25,254 23,754 26,851 11,840
zma-miR166m-5p GGAAUGUUGGCUGGCUCGAGG 21 1,774 71 295 1    0 1 45 25 7 0 0 12 2 3 12 33 14 124 29 55 143 233 0 295 112 102 132 221 174
zma-miR166n-3p UCGGACCAGGCUUCAAUCCCU 21 249,551 9,982 51,440 1    2,479 7,329 4,569 12,235 3,370 22 0 44 1 5 9 75 5,110 16,448 765 919 4,020 3,785 1,851 20,479 30,262 45,324 51,440 26,669 12,341
zma-miR166n-5p GGAUUGUUGUCUGGCUCGGUG 21 2,174 87 307 1    0 3 36 33 12 0 0 9 0 1 3 22 5 4 5 63 204 307 31 261 249 187 161 276 302
zma-miR167a-3p GAUCAUGCAUGACAGCCUCAUU 22 21 1 5 1    0 0 1 1 1 0 0 0 0 1 0 0 0 0 0 4 4 5 0 1 0 0 0 1 2
zma-miR167a-5p UGAAGCUGCCAGCAUGAUCUA 21 101,797 4,072 23,554 82    1,904 2,327 5,329 23,554 2,575 18,519 18,779 5,512 453 2,644 3,858 9,006 560 1,496 82 113 270 254 743 112 241 295 356 1,503 1,312
zma-miR167b-3p GAUCAUGCUGUGACAGUUUCACU 23 73 3 33 1    0 0 0 0 0 19 12 1 0 33 1 0 0 0 0 1 0 0 0 0 6 0 0 0 0
zma-miR167b-5p UGAAGCUGCCAGCAUGAUCUA 21 101,797 4,072 23,554 82    1,904 2,327 5,329 23,554 2,575 18,519 18,779 5,512 453 2,644 3,858 9,006 560 1,496 82 113 270 254 743 112 241 295 356 1,503 1,312
zma-miR167c-3p GAUCAUGCUGUGGCAGCCUCACU 23 4,625 185 2,188 1    0 0 23 11 2 3 2 1 0 0 0 9 154 786 0 5 0 4 1 344 2,188 100 29 639 324
zma-miR167c-5p UGAAGCUGCCAGCAUGAUCUA 21 101,797 4,072 23,554 82    1,904 2,327 5,329 23,554 2,575 18,519 18,779 5,512 453 2,644 3,858 9,006 560 1,496 82 113 270 254 743 112 241 295 356 1,503 1,312
zma-miR167d-3p GGUCAUGCUGCUGCAGCCUCACU 23 561 22 342 1    0 0 2 1 0 4 2 2 0 0 1 3 36 98 0 0 0 0 4 38 342 0 0 16 12
zma-miR167d-5p UGAAGCUGCCAGCAUGAUCUA 21 101,797 4,072 23,554 82    1,904 2,327 5,329 23,554 2,575 18,519 18,779 5,512 453 2,644 3,858 9,006 560 1,496 82 113 270 254 743 112 241 295 356 1,503 1,312
zma-miR167e-3p GAUCAUGCUGUGCAGUUUCAUC 22 383 15 265 1    1 0 0 0 0 6 4 1 2 25 22 0 13 12 0 0 0 0 17 15 265 0 0 0 0
zma-miR167e-5p UGAAGCUGCCAGCAUGAUCUG 21 63,008 2,520 15,825 4    7,287 13 14 42 4 15,570 15,825 69 34 1,807 3,187 17 630 259 10 16 147 116 1,851 228 15,483 139 220 19 21
zma-miR167f-3p GAUCGUGCUGCGCAGUUUCACC 22 173 7 91 1    2 0 0 0 0 44 29 0 1 0 3 0 0 0 0 0 0 0 0 3 91 0 0 0 0
zma-miR167f-5p UGAAGCUGCCAGCAUGAUCUG 21 63,008 2,520 15,825 4    7,287 13 14 42 4 15,570 15,825 69 34 1,807 3,187 17 630 259 10 16 147 116 1,851 228 15,483 139 220 19 21
zma-miR167g-3p GGUCAUGCUGUAGUUUCAUC 20 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
zma-miR167g-5p UGAAGCUGCCAGCAUGAUCUG 21 63,008 2,520 15,825 4    7,287 13 14 42 4 15,570 15,825 69 34 1,807 3,187 17 630 259 10 16 147 116 1,851 228 15,483 139 220 19 21
zma-miR167h-3p GAUCAUGUUGCAGCUUCAC 19 12 0 8 1    0 0 0 0 0 0 0 0 0 3 1 0 0 0 0 0 0 0 0 0 8 0 0 0 0
zma-miR167h-5p UGAAGCUGCCAGCAUGAUCUG 21 63,008 2,520 15,825 4    7,287 13 14 42 4 15,570 15,825 69 34 1,807 3,187 17 630 259 10 16 147 116 1,851 228 15,483 139 220 19 21
zma-miR167i-3p GAUCAUGUUGCAGCUUCAC 19 12 0 8 1    0 0 0 0 0 0 0 0 0 3 1 0 0 0 0 0 0 0 0 0 8 0 0 0 0
zma-miR167i-5p UGAAGCUGCCAGCAUGAUCUG 21 63,008 2,520 15,825 4    7,287 13 14 42 4 15,570 15,825 69 34 1,807 3,187 17 630 259 10 16 147 116 1,851 228 15,483 139 220 19 21
zma-miR167j-3p GAUCAUGUGGCAGUUUCAUU 20 2 0 1 1    0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR167j-5p UGAAGCUGCCAGCAUGAUCUG 21 63,008 2,520 15,825 4    7,287 13 14 42 4 15,570 15,825 69 34 1,807 3,187 17 630 259 10 16 147 116 1,851 228 15,483 139 220 19 21
zma-miR168a-3p CCCGCCUUGCACCAAGUGAA 20 416 17 141 1    0 0 0 0 0 1 2 0 9 4 3 0 0 0 5 7 53 15 17 69 141 35 49 1 5
zma-miR168a-5p UCGCUUGGUGCAGAUCGGGAC 21 1,313,819 52,553 385,286 972    31,988 4,170 23,738 73,728 14,539 141,246 127,770 3,062 5,490 21,090 13,961 2,806 972 3,245 2,541 9,223 17,124 17,417 385,286 19,329 380,789 3,884 6,475 2,230 1,716
zma-miR168b-3p CCCGCCUUGCAUCAAGUGAA 20 878 35 247 1    0 0 1 1 0 3 0 1 0 16 5 2 0 0 0 5 29 22 71 93 247 241 132 6 3
zma-miR168b-5p UCGCUUGGUGCAGAUCGGGAC 21 1,313,819 52,553 385,286 972    31,988 4,170 23,738 73,728 14,539 141,246 127,770 3,062 5,490 21,090 13,961 2,806 972 3,245 2,541 9,223 17,124 17,417 385,286 19,329 380,789 3,884 6,475 2,230 1,716
zma-miR169a-3p GGCAAGUUGUUCUUGGCUACA 21 14 1 7 1    0 0 0 2 0 1 0 0 0 0 1 0 7 0 0 0 0 0 2 0 0 0 0 1 0
zma-miR169a-5p CAGCCAAGGAUGACUUGCCGA 21 3,711 148 1,773 3    55 8 16 28 8 91 170 7 0 110 280 31 612 1,773 0 8 12 26 411 3 15 17 15 4 11
zma-miR169b-3p GGCAAGUUGUUCUUGGCUACA 21 14 1 7 1    0 0 0 2 0 1 0 0 0 0 1 0 7 0 0 0 0 0 2 0 0 0 0 1 0
zma-miR169b-5p CAGCCAAGGAUGACUUGCCGA 21 3,711 148 1,773 3    55 8 16 28 8 91 170 7 0 110 280 31 612 1,773 0 8 12 26 411 3 15 17 15 4 11
zma-miR169c-3p GGCAAGUCUGUCCUUGGCUACA 22 66 3 28 1    1 0 2 0 0 6 0 0 0 1 0 0 7 0 0 0 0 1 4 16 28 0 0 0 0
zma-miR169c-5p CAGCCAAGGAUGACUUGCCGG 21 34,473 1,379 19,229 1    376 3 35 10 0 1,324 4,317 234 13 6,790 19,229 335 610 989 0 1 0 1 157 11 38 0 0 0 0
zma-miR169d UAGCCAAGGAGACUGCCUAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169e UAGCCAAGGAGACUGCCUACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169f-3p GGCAUGUCUUCCUUGGCUACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169f-5p UAGCCAAGGAUGACUUGCCUA 21 1,999 80 1,581 1    2 0 1 3 2 54 43 19 1 154 1,581 24 45 8 0 0 0 0 3 8 51 0 0 0 0
zma-miR169g UAGCCAAGGAUGACUUGCCUA 21 1,999 80 1,581 1    2 0 1 3 2 54 43 19 1 154 1,581 24 45 8 0 0 0 0 3 8 51 0 0 0 0
zma-miR169h UAGCCAAGGAUGACUUGCCUA 21 1,999 80 1,581 1    2 0 1 3 2 54 43 19 1 154 1,581 24 45 8 0 0 0 0 3 8 51 0 0 0 0
zma-miR169i-3p GGCAGUCUCCUUGGCUAG 18 94 4 87 1    0 0 0 1 0 0 0 0 0 1 4 0 0 0 0 0 0 0 0 1 87 0 0 0 0
zma-miR169i-5p UAGCCAAGGAUGACUUGCCUG 21 2,437 97 693 1    30 0 1 10 4 188 113 4 9 693 338 29 465 242 0 0 0 0 8 48 254 0 0 0 1
zma-miR169j-3p GGCAGUCUCCUUGGCUAG 18 94 4 87 1    0 0 0 1 0 0 0 0 0 1 4 0 0 0 0 0 0 0 0 1 87 0 0 0 0
zma-miR169j-5p UAGCCAAGGAUGACUUGCCUG 21 2,437 97 693 1    30 0 1 10 4 188 113 4 9 693 338 29 465 242 0 0 0 0 8 48 254 0 0 0 1
zma-miR169k-3p GGCAGUCUCCUUGGCUAG 18 94 4 87 1    0 0 0 1 0 0 0 0 0 1 4 0 0 0 0 0 0 0 0 1 87 0 0 0 0
zma-miR169k-5p UAGCCAAGGAUGACUUGCCUG 21 2,437 97 693 1    30 0 1 10 4 188 113 4 9 693 338 29 465 242 0 0 0 0 8 48 254 0 0 0 1
zma-miR169l-3p GGCAAAUCAUCCCUGCUACC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169l-5p UAGCCAGGGAUGAUUUGCCUG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169m-3p GGCAUCCAUUCUUGGCUAAG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169m-5p UAGCCAAGAAUGGCUUGCCUA 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169n-3p GGCAGGCCUUCUUGGCUAAG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169n-5p UAGCCAAGAAUGGCUUGCCUA 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169o-3p GGCAGGUCUUCUUGGCUAGC 20 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
zma-miR169o-5p UAGCCAAGAAUGACUUGCCUA 21 8 0 3 1    0 0 0 1 0 0 0 0 1 3 1 0 0 0 0 0 0 0 2 0 0 0 0 0 0
zma-miR169p-3p GGCAAGUCAUCUGGGGCUACG 21 35 1 12 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 10 6 12 6 0 0 0 0 0 0 0
zma-miR169p-5p UAGCCAAGGAUGACUUGCCGG 21 11,949 478 6,571 1    0 128 52 123 46 4 2 589 64 69 141 655 2,442 6,571 43 73 168 158 576 0 1 26 10 4 4
zma-miR169q-3p GGCAGGCCUUCUGGCUAAG 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169q-5p UAGCCAAGAAUGGCUUGCCUA 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169r-3p GGCAAGUUGUCCUUGGCUACA 21 7 0 3 1    0 0 0 0 0 3 0 0 0 0 1 0 3 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169r-5p CAGCCAAGGAUGACUUGCCGG 21 34,473 1,379 19,229 1    376 3 35 10 0 1,324 4,317 234 13 6,790 19,229 335 610 989 0 1 0 1 157 11 38 0 0 0 0
zma-miR171a-3p UGAUUGAGCCGCGCCAAUAU 20 3 0 1 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 0 0 0 0 0 0
zma-miR171a-5p UAUUGGCGAGGUUCAAUCAGA 21 16 1 7 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 2 4 7 0 1 1 0 0 0 0
zma-miR171b-3p UUGAGCCGUGCCAAUAUCAC 20 1,756 70 618 1    3 0 4 0 0 1 0 4 0 0 4 7 1 2 197 165 618 566 183 0 0 0 0 1 0
zma-miR171b-5p GAUAUUGGCGCGGUUCAAUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171c-3p UGACUGAGCCGUGCCAAUAUC 21 100 4 28 1    0 0 0 0 0 0 0 3 1 9 28 12 3 8 0 0 8 4 21 0 0 0 0 1 2
zma-miR171c-5p UAUUGGUGCGGUUCAAUCAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171d-3p UGAUUGAGCCGUGCCAAUAUC 21 78,166 3,127 23,378 39    720 223 385 107 39 531 937 4,162 1,115 5,190 21,157 8,784 2,731 1,907 197 283 1,063 1,062 23,378 734 1,893 156 102 728 582
zma-miR171d-5p UGUUGGCUCGGCUCACUCAGA 21 7,963 319 3,309 1    19 5 87 246 36 0 0 32 1 3 90 83 330 1,798 19 33 57 83 45 733 3,309 237 146 378 193
zma-miR171e-3p UGAUUGAGCCGUGCCAAUAUC 21 78,166 3,127 23,378 39    720 223 385 107 39 531 937 4,162 1,115 5,190 21,157 8,784 2,731 1,907 197 283 1,063 1,062 23,378 734 1,893 156 102 728 582
zma-miR171e-5p UGUUGGCUCGGCUCACUCAGA 21 7,963 319 3,309 1    19 5 87 246 36 0 0 32 1 3 90 83 330 1,798 19 33 57 83 45 733 3,309 237 146 378 193
zma-miR171f-3p UUGAGCCGUGCCAAUAUCACA 21 167 7 98 1    0 0 0 0 0 0 0 0 0 0 1 1 0 0 19 8 98 30 8 0 0 0 0 1 1
zma-miR171f-5p CGAUGUUGGCAUGGCUCAAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171g-3p GAGGUGAGCCGAGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171g-5p UAUUGACUUGGCUCAUCUCUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171h-3p GUGAGCCGAACCAAUAUCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171h-5p UGGUAUUGUUUCGGCUCAUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171i-3p UGAUUGAGCCGUGCCAAUAUC 21 78,166 3,127 23,378 39    720 223 385 107 39 531 937 4,162 1,115 5,190 21,157 8,784 2,731 1,907 197 283 1,063 1,062 23,378 734 1,893 156 102 728 582
zma-miR171i-5p UGUUGGCACGGUUCAAUCAAA 21 143 6 69 1    0 0 0 0 0 12 16 0 69 17 1 0 0 0 0 0 0 0 26 0 2 0 0 0 0
zma-miR171j-3p UGAUUGAGCCGUGCCAAUAUC 21 78,166 3,127 23,378 39    720 223 385 107 39 531 937 4,162 1,115 5,190 21,157 8,784 2,731 1,907 197 283 1,063 1,062 23,378 734 1,893 156 102 728 582
zma-miR171j-5p UAUUGACGCGGUUCAAUUCGA 21 2 0 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0
zma-miR171k-3p GUGAGCCGAACCAAUAUCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171k-5p UGGUAUUGUUUCGGCUCAUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171l-3p GGAUUGAGCCGCGUCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171l-5p UAUUGGCGUGCCUCAAUCCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171m-3p GGAUUGAGCCGCGUCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171m-5p UAUUGGCGCGCCUCAAUCCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171n-3p UGAUUGAGCCGCGCCAAUAUC 21 209 8 66 1    0 0 0 0 0 0 2 9 5 12 66 25 20 8 5 0 0 20 36 0 1 0 0 0 0
zma-miR171n-5p UAUUGGUGAGGUUCAAUCCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR172a AGAAUCUUGAUGAUGCUGCA 20 317 13 134 1    13 5 7 43 11 7 14 1 1 0 0 1 134 59 0 1 0 4 2 3 10 0 0 1 0
zma-miR172b-3p AGAAUCUUGAUGAUGCUGCA 20 317 13 134 1    13 5 7 43 11 7 14 1 1 0 0 1 134 59 0 1 0 4 2 3 10 0 0 1 0
zma-miR172b-5p CAGCACCAUCAAGAUUCACA 20 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR172c-3p AGAAUCUUGAUGAUGCUGCA 20 317 13 134 1    13 5 7 43 11 7 14 1 1 0 0 1 134 59 0 1 0 4 2 3 10 0 0 1 0
zma-miR172c-5p CAGCACCACCAAGAUUCACA 20 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0
zma-miR172d-3p AGAAUCUUGAUGAUGCUGCA 20 317 13 134 1    13 5 7 43 11 7 14 1 1 0 0 1 134 59 0 1 0 4 2 3 10 0 0 1 0
zma-miR172d-5p CAGCACCAUCAAGAUUCACA 20 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR172e GGAAUCUUGAUGAUGCUGCAU 21 30,804 1,232 16,422 2    0 112 83 611 115 3 0 338 8 24 33 606 16,422 11,903 48 93 147 105 107 32 9 0 0 2 3
zma-miR2118a UUCCUGAUGCCUCUCAUUCCUA 22 19,159 766 8,070 1    0 1 2 38 8 0 0 0 0 0 0 0 0 4 0 0 4 2 0 6 3 2,232 2,408 6,381 8,070
zma-miR2118b UUCCCGAUGCCUCCCAUUCCUA 22 11,741 470 5,586 1    0 0 1 1 0 0 0 0 0 0 1 0 1 0 0 2 0 0 4 10 6 1,251 1,691 3,187 5,586
zma-miR2118c UUCCUAAUGCCUCCCAUUCCUA 22 17,528 701 8,840 1    0 0 2 1 2 0 0 0 0 0 0 0 0 0 0 1 0 0 0 3 0 879 1,110 6,690 8,840
zma-miR2118d UUCCUGAUGCCUCCCAUGCCUA 22 28,740 1,150 16,753 1    0 1 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 5 5 1,240 1,478 9,253 16,753
zma-miR2118e UUCCUGAUGUCUCCCAUUCCUA 22 3,333 133 1,480 1    0 0 1 2 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 304 395 1,150 1,480
zma-miR2118f UUCCCAAUGCCUUCCAUGCCUA 22 418 17 159 1    0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 80 49 128 159
zma-miR2118g UUCCUGAUGCCUCCUAUUCCUA 22 14,371 575 6,937 1    0 0 1 3 0 0 0 0 0 0 0 0 0 0 5 3 57 92 296 6 9 1,242 1,281 4,439 6,937
zma-miR2275a-3p UUUGUUUUCCUCCAAUAUCUCA 22 270 11 109 1    0 1 2 3 0 0 0 1 0 0 1 1 0 0 0 0 4 5 2 0 0 35 85 21 109
zma-miR2275a-5p AGAGUUGGAGGAAAGCAAACC 21 257 10 85 1    0 0 11 3 0 0 0 0 0 1 1 1 0 0 0 0 0 0 1 3 15 85 56 27 53
zma-miR2275b-3p UUCAGUUUCCUCUAAUAUCUCA 22 345 14 156 1    0 0 2 6 0 0 0 0 0 0 1 1 0 0 0 0 8 0 2 1 0 41 102 25 156
zma-miR2275b-5p AGGAUUAGAGGCAACUGAACC 21 14,697 588 6,969 1    0 0 14 1 0 0 0 0 0 1 1 1 0 0 0 0 0 0 0 17 24 6,969 6,772 111 786
zma-miR2275c-3p UUCAGUUUCCUCUAAUAUCUCA 22 345 14 156 1    0 0 2 6 0 0 0 0 0 0 1 1 0 0 0 0 8 0 2 1 0 41 102 25 156
zma-miR2275c-5p AGGAUUAGAGGGACUUGAACC 21 165 7 117 10    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 26 117 10 12
zma-miR2275d-3p UUUGUUUUCCUCUAAUAUCUCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR2275d-5p AGAGUUGGAGGAAAGAAAACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR319a-3p UUGGACUGAAGGGUGCUCCC 20 46,765 1,871 10,205 3    0 92 6 10 3 10 1,038 644 10 577 367 152 75 145 294 468 1,346 1,731 1,636 5,558 7,580 7,354 10,205 5,224 2,240
zma-miR319a-5p GAGCUCUCUUCAGUCCACUC 20 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0
zma-miR319b-3p UUGGACUGAAGGGUGCUCCC 20 46,765 1,871 10,205 3    0 92 6 10 3 10 1,038 644 10 577 367 152 75 145 294 468 1,346 1,731 1,636 5,558 7,580 7,354 10,205 5,224 2,240
zma-miR319b-5p AGAGCGUCCUUCAGUCCACUC 21 4,044 162 1,774 1    0 6 1 11 2 0 0 297 12 609 78 9 120 120 5 17 94 132 1,774 217 523 4 0 7 6
zma-miR319c-3p UUGGACUGAAGGGUGCUCCC 20 46,765 1,871 10,205 3    0 92 6 10 3 10 1,038 644 10 577 367 152 75 145 294 468 1,346 1,731 1,636 5,558 7,580 7,354 10,205 5,224 2,240
zma-miR319c-5p GAGCUCUCUUCAGUCCACUC 20 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0
zma-miR319d-3p UUGGACUGAAGGGUGCUCCC 20 46,765 1,871 10,205 3    0 92 6 10 3 10 1,038 644 10 577 367 152 75 145 294 468 1,346 1,731 1,636 5,558 7,580 7,354 10,205 5,224 2,240
zma-miR319d-5p AGAGCGUCCUUCAGUCCACUC 21 4,044 162 1,774 1    0 6 1 11 2 0 0 297 12 609 78 9 120 120 5 17 94 132 1,774 217 523 4 0 7 6
zma-miR390a-3p CGCUAUCUAUCCUGAGCUCCA 21 373 15 112 1    0 0 8 1 1 1 2 5 4 13 27 34 3 14 0 7 53 112 13 33 41 0 0 0 1
zma-miR390a-5p AAGCUCAGGAGGGAUAGCGCC 21 22,188 888 10,696 6    488 66 173 70 14 11 6 169 139 237 2,251 594 279 108 154 256 900 1,682 362 2,261 10,696 145 266 594 267
zma-miR390b-3p CGCUAUCUAUCCUGAGCUCCA 21 373 15 112 1    0 0 8 1 1 1 2 5 4 13 27 34 3 14 0 7 53 112 13 33 41 0 0 0 1
zma-miR390b-5p AAGCUCAGGAGGGAUAGCGCC 21 22,188 888 10,696 6    488 66 173 70 14 11 6 169 139 237 2,251 594 279 108 154 256 900 1,682 362 2,261 10,696 145 266 594 267
zma-miR393a-3p AUCAGUGCAAUCCCUUUGGAAU 22 3 0 2 1    0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR393a-5p UCCAAAGGGAUCGCAUUGAUCU 22 2,574 103 2,540 1    0 0 0 0 0 0 0 0 0 1 3 1 0 0 0 0 0 0 0 19 2,540 4 5 1 0
zma-miR393b-3p AUCAAUGCGAUCCUUUUGGAGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR393b-5p UCCAAAGGGAUCGCAUUGAUCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR393c-3p GUCAGUGCAAUCCCUUUGGAAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR393c-5p UCCAAAGGGAUCGCAUUGAUCU 22 2,574 103 2,540 1    0 0 0 0 0 0 0 0 0 1 3 1 0 0 0 0 0 0 0 19 2,540 4 5 1 0
zma-miR394a-3p AGGUGGGCAUACUGCCAAUG 20 45 2 16 1    0 0 0 1 2 0 0 1 0 0 1 1 2 8 0 0 16 6 0 1 2 0 0 3 1
zma-miR394a-5p UUGGCAUUCUGUCCACCUCC 20 70,918 2,837 42,148 1    142 147 155 22 27 66 102 6 1 9 4 44 42,148 24,561 14 66 139 94 607 695 885 89 127 445 323
zma-miR394b-3p AGGUGGGCAUACUGCCAAUG 20 45 2 16 1    0 0 0 1 2 0 0 1 0 0 1 1 2 8 0 0 16 6 0 1 2 0 0 3 1
zma-miR394b-5p UUGGCAUUCUGUCCACCUCC 20 70,918 2,837 42,148 1    142 147 155 22 27 66 102 6 1 9 4 44 42,148 24,561 14 66 139 94 607 695 885 89 127 445 323
zma-miR395a-3p GUGAAGUGUUUGGGGGAACUC 21 8 0 7 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 7 0 0 0 0
zma-miR395a-5p GUUCUCCUCAAACCACUUCAGUU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395b-3p GUGAAGUGUUUGGGGGAACUC 21 8 0 7 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 7 0 0 0 0
zma-miR395b-5p GUUCCCUACAAGCACUUCACAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395c-3p GUGAAGUGUUUGGAGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395c-5p GUUCCCUGCAAACACUUCACCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395d-3p GUGAAGUGUUUGGGGGAACUC 21 8 0 7 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 7 0 0 0 0
zma-miR395d-5p GUUCUAUGCAAGCACUUCACGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395e-3p GUGAAGUGUUUGGGGGAACUC 21 8 0 7 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 7 0 0 0 0
zma-miR395e-5p GUUCCCUUCAAGCACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395f-3p GUGAAGUGUUUGGGGGAACUC 21 8 0 7 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 7 0 0 0 0
zma-miR395f-5p GUUACCUACAAGCACGUCUCGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395g-3p GUGAAGUGUUUGGGGGAACUC 21 8 0 7 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 7 0 0 0 0
zma-miR395g-5p GUUCUAUGCAAGCACUUCACGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395h-3p GUGAAGUGUUUGGGGGAACUC 21 8 0 7 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 7 0 0 0 0
zma-miR395h-5p GUUCCCUUCAAGCACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395i-3p GUGAAGUGUUUGGGGGAACUC 21 8 0 7 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 7 0 0 0 0
zma-miR395i-5p GUUCCCUACAAGCACUUCACGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395j-3p GUGAAGUGUUUGGGGGAACUC 21 8 0 7 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 7 0 0 0 0
zma-miR395j-5p GUUCCCUUCAAGCACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395k-3p GUGAAGUGUUUGAGGAAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395k-5p GUUUCCUUCAAGCACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395l-3p GUGAAGUGUUUGGAGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395l-5p GUUCCUUCCAAACACUUCACCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395m-3p GUGAAGUGUUUGGAGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395m-5p GUUCCUUUCAAACACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395n-3p GUGAAGUGUUUGGGGGAACUC 21 8 0 7 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 7 0 0 0 0
zma-miR395n-5p GUUCUCUACAAGCACUUCACGA 22 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395o-3p GUGAAGUGUUUGGGUGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395o-5p GUUCUCUUCAAGCACUUCACGA 22 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
zma-miR395p-3p GUGAAGUGUUUGGGGGAACUC 21 8 0 7 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 7 0 0 0 0
zma-miR395p-5p GUUCCCUUCAAGCACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR396a-3p GUUCAAUAAAGCUGUGGGAAA 21 1,824 73 409 2    68 0 12 13 2 24 29 5 409 242 184 15 2 0 0 107 90 301 102 39 148 9 7 10 6
zma-miR396a-5p UUCCACAGCUUUCUUGAACUG 21 4,894 196 974 4    224 23 25 51 9 127 690 4 32 27 46 7 150 110 111 226 585 607 92 974 291 63 78 224 118
zma-miR396b-3p GUUCAAUAAAGCUGUGGGAAA 21 1,824 73 409 2    68 0 12 13 2 24 29 5 409 242 184 15 2 0 0 107 90 301 102 39 148 9 7 10 6
zma-miR396b-5p UUCCACAGCUUUCUUGAACUG 21 4,894 196 974 4    224 23 25 51 9 127 690 4 32 27 46 7 150 110 111 226 585 607 92 974 291 63 78 224 118
zma-miR396c UUCCACAGGCUUUCUUGAACUG 22 9 0 3 1    0 0 0 0 0 1 2 0 0 0 1 0 0 0 0 0 0 0 0 3 2 0 0 0 0
zma-miR396d UUCCACAGGCUUUCUUGAACUG 22 9 0 3 1    0 0 0 0 0 1 2 0 0 0 1 0 0 0 0 0 0 0 0 3 2 0 0 0 0
zma-miR396e-3p GGUCAAGAAAGCCGUGGGAAG 21 2 0 1 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0
zma-miR396e-5p UUCCACAGCUUUCUUGAACUU 21 19,566 783 15,241 1    242 1 6 0 0 95 184 10 2 3 586 35 1 0 0 3 25 9 23 2,591 15,241 167 183 102 57
zma-miR396f-3p GGUCAAGAAAGCUGUGGGAAG 21 1,098 44 535 2    119 0 16 2 0 0 2 9 0 3 535 26 0 0 0 3 0 21 46 142 174 0 0 0 0
zma-miR396f-5p UUCCACAGCUUUCUUGAACUU 21 19,566 783 15,241 1    242 1 6 0 0 95 184 10 2 3 586 35 1 0 0 3 25 9 23 2,591 15,241 167 183 102 57
zma-miR396g-3p GUUCAAGAAAGCUGUGGAAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR396g-5p UCCCACAGCUUUAUUGAACUG 21 9 0 4 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 2 4 0 0 0
zma-miR396h UCCCACAGCUUUAUUGAACUG 21 9 0 4 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 2 4 0 0 0
zma-miR397a-3p UAGCCGUUAGCGCUCAUUAACU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR397a-5p UCAUUGAGCGCAGCGUUGAUG 21 36 1 14 1    1 0 0 1 1 0 2 1 7 7 14 2 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR397b-3p CCAGCGCUGCACUCAAUUACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR397b-5p UCAUUGAGCGCAGCGUUGAUG 21 36 1 14 1    1 0 0 1 1 0 2 1 7 7 14 2 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR398a-3p UGUGUUCUCAGGUCGCCCCCG 21 2,557 102 715 1    3 0 2 1 1 2 133 1 16 51 109 34 0 4 24 26 110 72 1 63 27 408 715 647 107
zma-miR398a-5p GGGGCGAACUGAGAACACAUG 21 20 1 5 1    0 0 0 0 0 0 0 0 1 3 5 1 0 0 0 0 4 0 0 3 3 0 0 0 0
zma-miR398b-3p UGUGUUCUCAGGUCGCCCCCG 21 2,557 102 715 1    3 0 2 1 1 2 133 1 16 51 109 34 0 4 24 26 110 72 1 63 27 408 715 647 107
zma-miR398b-5p GGGGCGGACUGGGAACACAUG 21 315 13 65 1    0 0 2 0 0 0 0 1 4 33 31 6 0 0 0 2 4 0 0 65 50 30 46 32 9
zma-miR399a-3p UGCCAAAGGAGAAUUGCCCUG 21 500 20 243 1    243 0 0 2 0 1 0 3 0 115 55 2 1 0 5 3 12 10 36 2 1 0 0 4 5
zma-miR399a-5p GUGCGGUUCUCCUCUGGCACG 21 6 0 5 1    5 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR399b-3p UGCCAAAGGAGAGCUGUCCUG 21 159 6 147 1    147 0 0 0 0 0 0 0 1 2 1 0 0 0 0 0 0 0 8 0 0 0 0 0 0
zma-miR399b-5p GUGCAGCUCUCCUCUGGCAUG 21 522 21 522 522    522 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR399c-3p UGCCAAAGGAGAAUUGCCCUG 21 500 20 243 1    243 0 0 2 0 1 0 3 0 115 55 2 1 0 5 3 12 10 36 2 1 0 0 4 5
zma-miR399c-5p GGGUACGUCUCCUUUGGCACA 21 97 4 40 2    40 0 0 3 0 0 0 0 0 0 0 0 0 2 5 2 12 30 3 0 0 0 0 0 0
zma-miR399d-3p UGCCAAAGGAGAGCUGCCCUG 21 58 2 52 1    52 0 0 0 0 0 0 1 3 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0
zma-miR399d-5p GUGUGGCUCUCCUCUGGCAUG 21 292 12 275 1    275 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 4 11 0 0 0 0 0 0 0
zma-miR399e-3p UGCCAAAGGAGAGUUGCCCUG 21 845 34 271 1    247 0 2 5 2 1 18 13 1 24 47 6 3 4 10 15 49 74 271 36 7 0 0 8 2
zma-miR399e-5p GGGCUUCUCUUUCUUGGCAGG 21 434 17 240 1    14 0 0 0 0 2 2 1 0 1 0 0 0 0 5 26 139 240 2 1 1 0 0 0 0
zma-miR399f-3p UGCCAAAGGAAAUUUGCCCCG 21 56 2 19 1    19 0 0 0 0 0 0 1 1 0 13 0 0 0 0 2 4 1 11 1 2 0 0 0 1
zma-miR399f-5p GGGCAACUUCUCCUUUGGCAGA 22 415 17 201 1    31 0 0 0 0 1 0 0 0 0 0 0 0 0 10 16 155 201 0 0 0 0 0 0 1
zma-miR399g-3p UGCCAAAGGGGAUUUGCCCGG 21 164 7 140 1    6 0 0 0 0 1 0 1 1 14 140 0 0 0 0 0 0 0 1 0 0 0 0 0 0
zma-miR399g-5p GGGCAACCCCCCGUUGGCAGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR399h-3p UGCCAAAGGAGAAUUGCCCUG 21 500 20 243 1    243 0 0 2 0 1 0 3 0 115 55 2 1 0 5 3 12 10 36 2 1 0 0 4 5
zma-miR399h-5p GUGCAGUUCUCCUCUGGCACG 21 13 1 8 1    8 0 0 0 0 0 0 0 0 1 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0
zma-miR399i-3p UGCCAAAGGAGAGUUGCCCUG 21 845 34 271 1    247 0 2 5 2 1 18 13 1 24 47 6 3 4 10 15 49 74 271 36 7 0 0 8 2
zma-miR399i-5p GUGCGGCUCUCCUCUGGCAUG 21 1 0 1 1    1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR399j-3p UGCCAAAGGAGAGUUGCCCUG 21 845 34 271 1    247 0 2 5 2 1 18 13 1 24 47 6 3 4 10 15 49 74 271 36 7 0 0 8 2
zma-miR399j-5p AGGCAGCUCUCCUCUGGCAGG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0
zma-miR408a CUGCACUGCCUCUUCCCUGGC 21 11,166 447 2,548 1    57 0 8 5 1 65 993 0 6 65 30 8 1 8 255 222 2,548 1,176 16 99 470 1,274 1,752 1,896 211
zma-miR408b-3p CUGCACUGCCUCUUCCCUGGC 21 11,166 447 2,548 1    57 0 8 5 1 65 993 0 6 65 30 8 1 8 255 222 2,548 1,176 16 99 470 1,274 1,752 1,896 211
zma-miR408b-5p CAGGGACGAGGCAGAGCAUGG 21 309 12 148 1    1 0 1 0 0 0 0 0 1 4 3 1 0 0 0 0 0 0 0 2 9 148 66 60 13
zma-miR444a UGCAGUUGUUGUCUCAAGCUU 21 8,924 357 1,050 10    929 194 165 486 56 644 768 73 130 512 508 46 993 318 10 16 16 23 27 1,050 905 111 188 481 275
zma-miR444b UGCAGUUGUUGUCUCAAGCUU 21 8,924 357 1,050 10    929 194 165 486 56 644 768 73 130 512 508 46 993 318 10 16 16 23 27 1,050 905 111 188 481 275
zma-miR482-3p UCUUCCUUGUUCCUCCCAUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR482-5p UGGGAGAUGAAGGAGCCUU 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR528a-3p CCUGUGCCUGCCUCUUCCAUU 21 369 15 79 1    0 0 0 0 1 0 0 0 0 0 0 0 0 0 5 13 12 33 3 32 79 56 56 64 15
zma-miR528a-5p UGGAAGGGGCAUGCAGAGGAG 21 11,366 455 1,974 2    1,974 9 829 827 65 122 327 9 28 179 149 354 2 0 38 127 221 350 1,958 155 41 751 732 1,896 223
zma-miR528b-3p CCUGUGCCUGCCUCUUCCAUU 21 369 15 79 1    0 0 0 0 1 0 0 0 0 0 0 0 0 0 5 13 12 33 3 32 79 56 56 64 15
zma-miR528b-5p UGGAAGGGGCAUGCAGAGGAG 21 11,366 455 1,974 2    1,974 9 829 827 65 122 327 9 28 179 149 354 2 0 38 127 221 350 1,958 155 41 751 732 1,896 223
zma-miR529-3p GCUGUACCCUCUCUCUUCUUC 21 1,852 74 542 1    0 0 12 39 191 0 0 1 2 7 1 123 1 0 5 1 12 2 37 10 256 165 198 542 247
zma-miR529-5p AGAAGAGAGAGAGUACAGCCU 21 690,168 27,607 384,324 1    0 4 1,921 641 1,458 1 2 70 228 877 480 17,766 15 0 125 18 262 106 9,864 4,497 11,325 69,330 53,919 384,324 132,935
zma-miR827-3p UUAGAUGACCAUCAGCAAACA 21 41,837 1,673 14,161 40    7,884 564 342 139 46 6,744 5,721 272 40 645 783 375 40 0 356 441 1,010 1,162 14,161 412 395 111 59 90 45
zma-miR827-5p UUUGUUGGUGGUCAUUUAACC 21 1,220 49 892 2    71 2 2 12 0 21 35 0 0 5 7 3 0 0 14 5 53 67 892 8 23 0 0 0 0