Maize PARE miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  B73p1_plnmop1_pln1_0w1_52_0w2_5w3_04_0wPollenB73_ear_IB73_ear_IIB73_ear_IIIB73_ear_IV
zma-miR11969-3p UUAUACCCAUCUCUCACCUUGCAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR11969-5p GCAAGGUCAGAGAAGGAUAUAAUC 24 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR11970-3p UGGUUUGGUUGCACGUUUGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR11970-5p CAAGCGUGCAAGCAAACCAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR1432-3p GGGUGUCAUCUCGCCUGAAGCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR1432-5p CUCAGGAGAGAUGACACCGAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR156a-3p GCUCACUUCUCUCUCUGUCAGU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR156a-5p UGACAGAAGAGAGUGAGCAC 20 290 32 110 6    33 17 6 0 10 98 110 0 16
zma-miR156b-3p GCUCACCCUCUAUCUGUCAGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 290 32 110 6    33 17 6 0 10 98 110 0 16
zma-miR156c UGACAGAAGAGAGUGAGCAC 20 290 32 110 6    33 17 6 0 10 98 110 0 16
zma-miR156d-3p GCUCACUUCUCUUUCUGUCAGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 290 32 110 6    33 17 6 0 10 98 110 0 16
zma-miR156e-3p GCUCACUGCUCUCUCUGUCAUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR156e-5p UGACAGAAGAGAGUGAGCAC 20 290 32 110 6    33 17 6 0 10 98 110 0 16
zma-miR156f-3p GCUCACUUCUCUUUCUGUCAGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR156f-5p UGACAGAAGAGAGUGAGCAC 20 290 32 110 6    33 17 6 0 10 98 110 0 16
zma-miR156g-3p GCUCACUUCUCUUUCUGUCAGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR156g-5p UGACAGAAGAGAGUGAGCAC 20 290 32 110 6    33 17 6 0 10 98 110 0 16
zma-miR156h-3p GCUCACUGCUCUUUCUGUCAUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR156h-5p UGACAGAAGAGAGUGAGCAC 20 290 32 110 6    33 17 6 0 10 98 110 0 16
zma-miR156i-3p GCUCACUGCUCUAUCUGUCAUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR156i-5p UGACAGAAGAGAGUGAGCAC 20 290 32 110 6    33 17 6 0 10 98 110 0 16
zma-miR156j-3p UGCUCUCUGCUCUCACUGUCAUC 23 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR156j-5p UGACAGAAGAGAGAGAGCACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR156k-3p GCUCGCUUCUCUUUCUGUCAGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR156k-5p UGACAGAAGAGAGCGAGCAC 20 18 2 9 1    0 0 1 0 1 7 9 0 0
zma-miR156l-3p GCUCACUGCUCUAUCUGUCACC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR156l-5p UGACAGAAGAGAGUGAGCAC 20 290 32 110 6    33 17 6 0 10 98 110 0 16
zma-miR159a-3p UUUGGAUUGAAGGGAGCUCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR159a-5p GAGCUCCUAUCAUUCCAAUGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR159b-3p UUUGGAUUGAAGGGAGCUCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR159b-5p GUGCUCCCUUCAAACCAAUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR159c-3p CUUGGAUUGAAGGGAGCUCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR159c-5p GAGCUCCCUUCGAUCCAAUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR159d-3p CUUGGAUUGAAGGGAGCUCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR159d-5p GAGCUCCCUUCGAUCCAAUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR159e-3p AUUGGUUUGAAGGGAGCUCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR159e-5p CAGCUCCUGCAGCAUCUGUUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR159f-3p UUUGGAUUGAAGGGAGCUCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR159f-5p GAGCUCCUCUCAUUCCAAUGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR159g-3p UUUGGAGUGAAGGGAGUUCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR159g-5p GUGCUCCCUUCACACCAAUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR159h-3p UUUGGAGUGAAGGGAGCUCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR159h-5p GUGCUCCCUUCACACCAAUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR159i-3p UUUGGAGUGAAGGGAGCUCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR159i-5p GUGCUCCCUUCACACCAAUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR159j-3p UUUGGAUUGAAGGGAGCUCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR159j-5p GUGCUCCCUUCAAACCAAUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR159k-3p UUUGGAUUGAAGGGAGCUCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR159k-5p GUGCUCCCUUCAAACCAAUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR160a-3p GCGUGCAAGGGGCCAAGCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR160b-3p GCGUGCAAGGAGCCAAGCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR160b-5p UGCCUGGCUCCCUGUAUGCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR160c-3p GCGUGCAUGGUGCCAAGCAUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR160d-3p GCGUGCGUGGAGCCAAGCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR160d-5p UGCCUGGCUCCCUGUAUGCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR160e UGCCUGGCUCCCUGUAUGCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR160f-3p GCGUGCGAGGUGCCAGGCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR160f-5p UGCCUGGCUCCCUGUAUGCCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR160g-3p GCGUGCAAGGAGCCAAGCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR160g-5p UGCCUGGCUCCCUGUAUGCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR162-3p UCGAUAAACCUCUGCAUCCA 20 153 17 63 1    1 0 4 1 1 63 14 50 19
zma-miR162-5p GGGCGCAGUGGUUUAUCGAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR164a-3p CACGUGUUCUCCUUCUCCAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR164a-5p UGGAGAAGCAGGGCACGUGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR164b-3p AUGUGCCCAUCUUCUCCACC 20 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR164b-5p UGGAGAAGCAGGGCACGUGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR164c-3p CAUGUGCCCUUCUUCUCCAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR164c-5p UGGAGAAGCAGGGCACGUGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR164d-3p CACGUGGUCUCCUUCUCCAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR164d-5p UGGAGAAGCAGGGCACGUGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR164e-3p CAUGUGUCCGCCCUCUCCACC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR164e-5p UGGAGAAGCAGGACACGUGAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR164f-3p CACGUGCGCUCCUUCUCCAAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR164f-5p UGGAGAAGCAGGGCACGUGCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR164g-3p CACGUGCUCCCCUUCUCCACC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR164g-5p UGGAGAAGCAGGGCACGUGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR164h-3p CAUGUGCCCUUCUUCUCCAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR164h-5p UGGAGAAGCAGGGCACGUGUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR166a-5p GGAAUGUUGUCUGGCUCGGGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR166b-3p UCGGACCAGGCUUCAUUCCC 20 19 2 18 1    0 0 1 0 0 0 18 0 0
zma-miR166b-5p GGAAUGUUGUCUGGUUCAAGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR166c-3p UCGGACCAGGCUUCAUUCCC 20 19 2 18 1    0 0 1 0 0 0 18 0 0
zma-miR166c-5p GGAAUGUUGUCUGGCUCGAGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR166d-3p UCGGACCAGGCUUCAUUCCC 20 19 2 18 1    0 0 1 0 0 0 18 0 0
zma-miR166d-5p GGAAUGUUGUCUGGUUCAAGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR166e UCGGACCAGGCUUCAUUCCC 20 19 2 18 1    0 0 1 0 0 0 18 0 0
zma-miR166f UCGGACCAGGCUUCAUUCCC 20 19 2 18 1    0 0 1 0 0 0 18 0 0
zma-miR166g-3p UCGGACCAGGCUUCAUUCCC 20 19 2 18 1    0 0 1 0 0 0 18 0 0
zma-miR166g-5p GGAAUGUUGUCUGGUUGGAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR166h-3p UCGGACCAGGCUUCAUUCCC 20 19 2 18 1    0 0 1 0 0 0 18 0 0
zma-miR166h-5p GGAAUGACGUCCGGUCCGAAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR166i-3p UCGGACCAGGCUUCAUUCCC 20 19 2 18 1    0 0 1 0 0 0 18 0 0
zma-miR166i-5p GGAAUGUCGUCUGGCGCGAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR166j-3p UCGGACCAGGCUUCAAUCCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR166j-5p GGUUUGUUUGUCUGGUUCAAGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR166k-3p UCGGACCAGGCUUCAAUCCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR166k-5p GGAUUGUUGUCUGGCUCGGGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR166l-3p UCGGACCAGGCUUCAUUCCUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR166l-5p GAAUGGAGGCUGGUCCAAGA 20 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR166m-3p UCGGACCAGGCUUCAUUCCUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR166m-5p GGAAUGUUGGCUGGCUCGAGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR166n-3p UCGGACCAGGCUUCAAUCCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR166n-5p GGAUUGUUGUCUGGCUCGGUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR167a-3p GAUCAUGCAUGACAGCCUCAUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR167a-5p UGAAGCUGCCAGCAUGAUCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR167b-3p GAUCAUGCUGUGACAGUUUCACU 23 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR167b-5p UGAAGCUGCCAGCAUGAUCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR167c-3p GAUCAUGCUGUGGCAGCCUCACU 23 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR167c-5p UGAAGCUGCCAGCAUGAUCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR167d-3p GGUCAUGCUGCUGCAGCCUCACU 23 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR167d-5p UGAAGCUGCCAGCAUGAUCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR167e-3p GAUCAUGCUGUGCAGUUUCAUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR167e-5p UGAAGCUGCCAGCAUGAUCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR167f-3p GAUCGUGCUGCGCAGUUUCACC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR167f-5p UGAAGCUGCCAGCAUGAUCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR167g-3p GGUCAUGCUGUAGUUUCAUC 20 1 0 1 1    0 0 1 0 0 0 0 0 0
zma-miR167g-5p UGAAGCUGCCAGCAUGAUCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR167h-3p GAUCAUGUUGCAGCUUCAC 19 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR167h-5p UGAAGCUGCCAGCAUGAUCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR167i-3p GAUCAUGUUGCAGCUUCAC 19 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR167i-5p UGAAGCUGCCAGCAUGAUCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR167j-3p GAUCAUGUGGCAGUUUCAUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR167j-5p UGAAGCUGCCAGCAUGAUCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR168a-3p CCCGCCUUGCACCAAGUGAA 20 10 1 3 1    3 1 3 0 2 0 1 0 0
zma-miR168a-5p UCGCUUGGUGCAGAUCGGGAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR168b-3p CCCGCCUUGCAUCAAGUGAA 20 3 0 2 1    0 0 2 1 0 0 0 0 0
zma-miR168b-5p UCGCUUGGUGCAGAUCGGGAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169a-3p GGCAAGUUGUUCUUGGCUACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169a-5p CAGCCAAGGAUGACUUGCCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169b-3p GGCAAGUUGUUCUUGGCUACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169b-5p CAGCCAAGGAUGACUUGCCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169c-3p GGCAAGUCUGUCCUUGGCUACA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169c-5p CAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169d UAGCCAAGGAGACUGCCUAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169e UAGCCAAGGAGACUGCCUACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169f-3p GGCAUGUCUUCCUUGGCUACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169f-5p UAGCCAAGGAUGACUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169g UAGCCAAGGAUGACUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169h UAGCCAAGGAUGACUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169i-3p GGCAGUCUCCUUGGCUAG 18 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169i-5p UAGCCAAGGAUGACUUGCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169j-3p GGCAGUCUCCUUGGCUAG 18 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169j-5p UAGCCAAGGAUGACUUGCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169k-3p GGCAGUCUCCUUGGCUAG 18 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169k-5p UAGCCAAGGAUGACUUGCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169l-3p GGCAAAUCAUCCCUGCUACC 20 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169l-5p UAGCCAGGGAUGAUUUGCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169m-3p GGCAUCCAUUCUUGGCUAAG 20 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169m-5p UAGCCAAGAAUGGCUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169n-3p GGCAGGCCUUCUUGGCUAAG 20 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169n-5p UAGCCAAGAAUGGCUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169o-3p GGCAGGUCUUCUUGGCUAGC 20 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169o-5p UAGCCAAGAAUGACUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169p-3p GGCAAGUCAUCUGGGGCUACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169p-5p UAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169q-3p GGCAGGCCUUCUGGCUAAG 19 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169q-5p UAGCCAAGAAUGGCUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169r-3p GGCAAGUUGUCCUUGGCUACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR169r-5p CAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR171a-3p UGAUUGAGCCGCGCCAAUAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR171a-5p UAUUGGCGAGGUUCAAUCAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR171b-3p UUGAGCCGUGCCAAUAUCAC 20 12 1 6 1    0 0 0 2 0 1 6 0 3
zma-miR171b-5p GAUAUUGGCGCGGUUCAAUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR171c-3p UGACUGAGCCGUGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR171c-5p UAUUGGUGCGGUUCAAUCAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR171d-3p UGAUUGAGCCGUGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR171d-5p UGUUGGCUCGGCUCACUCAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR171e-3p UGAUUGAGCCGUGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR171e-5p UGUUGGCUCGGCUCACUCAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR171f-3p UUGAGCCGUGCCAAUAUCACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR171f-5p CGAUGUUGGCAUGGCUCAAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR171g-3p GAGGUGAGCCGAGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR171g-5p UAUUGACUUGGCUCAUCUCUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR171h-3p GUGAGCCGAACCAAUAUCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR171h-5p UGGUAUUGUUUCGGCUCAUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR171i-3p UGAUUGAGCCGUGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR171i-5p UGUUGGCACGGUUCAAUCAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR171j-3p UGAUUGAGCCGUGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR171j-5p UAUUGACGCGGUUCAAUUCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR171k-3p GUGAGCCGAACCAAUAUCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR171k-5p UGGUAUUGUUUCGGCUCAUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR171l-3p GGAUUGAGCCGCGUCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR171l-5p UAUUGGCGUGCCUCAAUCCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR171m-3p GGAUUGAGCCGCGUCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR171m-5p UAUUGGCGCGCCUCAAUCCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR171n-3p UGAUUGAGCCGCGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR171n-5p UAUUGGUGAGGUUCAAUCCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR172a AGAAUCUUGAUGAUGCUGCA 20 7 1 6 1    0 0 1 0 0 0 0 6 0
zma-miR172b-3p AGAAUCUUGAUGAUGCUGCA 20 7 1 6 1    0 0 1 0 0 0 0 6 0
zma-miR172b-5p CAGCACCAUCAAGAUUCACA 20 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR172c-3p AGAAUCUUGAUGAUGCUGCA 20 7 1 6 1    0 0 1 0 0 0 0 6 0
zma-miR172c-5p CAGCACCACCAAGAUUCACA 20 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR172d-3p AGAAUCUUGAUGAUGCUGCA 20 7 1 6 1    0 0 1 0 0 0 0 6 0
zma-miR172d-5p CAGCACCAUCAAGAUUCACA 20 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR172e GGAAUCUUGAUGAUGCUGCAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR2118a UUCCUGAUGCCUCUCAUUCCUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR2118b UUCCCGAUGCCUCCCAUUCCUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR2118c UUCCUAAUGCCUCCCAUUCCUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR2118d UUCCUGAUGCCUCCCAUGCCUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR2118e UUCCUGAUGUCUCCCAUUCCUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR2118f UUCCCAAUGCCUUCCAUGCCUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR2118g UUCCUGAUGCCUCCUAUUCCUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR2275a-3p UUUGUUUUCCUCCAAUAUCUCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR2275a-5p AGAGUUGGAGGAAAGCAAACC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR2275b-3p UUCAGUUUCCUCUAAUAUCUCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR2275b-5p AGGAUUAGAGGCAACUGAACC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR2275c-3p UUCAGUUUCCUCUAAUAUCUCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR2275c-5p AGGAUUAGAGGGACUUGAACC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR2275d-3p UUUGUUUUCCUCUAAUAUCUCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR2275d-5p AGAGUUGGAGGAAAGAAAACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR319a-3p UUGGACUGAAGGGUGCUCCC 20 35 4 13 5    0 0 0 0 0 10 5 13 7
zma-miR319a-5p GAGCUCUCUUCAGUCCACUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR319b-3p UUGGACUGAAGGGUGCUCCC 20 35 4 13 5    0 0 0 0 0 10 5 13 7
zma-miR319b-5p AGAGCGUCCUUCAGUCCACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR319c-3p UUGGACUGAAGGGUGCUCCC 20 35 4 13 5    0 0 0 0 0 10 5 13 7
zma-miR319c-5p GAGCUCUCUUCAGUCCACUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR319d-3p UUGGACUGAAGGGUGCUCCC 20 35 4 13 5    0 0 0 0 0 10 5 13 7
zma-miR319d-5p AGAGCGUCCUUCAGUCCACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR390a-3p CGCUAUCUAUCCUGAGCUCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR390a-5p AAGCUCAGGAGGGAUAGCGCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR390b-3p CGCUAUCUAUCCUGAGCUCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR390b-5p AAGCUCAGGAGGGAUAGCGCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR393a-3p AUCAGUGCAAUCCCUUUGGAAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR393a-5p UCCAAAGGGAUCGCAUUGAUCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR393b-3p AUCAAUGCGAUCCUUUUGGAGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR393b-5p UCCAAAGGGAUCGCAUUGAUCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR393c-3p GUCAGUGCAAUCCCUUUGGAAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR393c-5p UCCAAAGGGAUCGCAUUGAUCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR394a-3p AGGUGGGCAUACUGCCAAUG 20 1 0 1 1    0 0 0 1 0 0 0 0 0
zma-miR394a-5p UUGGCAUUCUGUCCACCUCC 20 10 1 7 1    0 0 0 2 1 0 7 0 0
zma-miR394b-3p AGGUGGGCAUACUGCCAAUG 20 1 0 1 1    0 0 0 1 0 0 0 0 0
zma-miR394b-5p UUGGCAUUCUGUCCACCUCC 20 10 1 7 1    0 0 0 2 1 0 7 0 0
zma-miR395a-3p GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395a-5p GUUCUCCUCAAACCACUUCAGUU 23 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395b-3p GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395b-5p GUUCCCUACAAGCACUUCACAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395c-3p GUGAAGUGUUUGGAGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395c-5p GUUCCCUGCAAACACUUCACCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395d-3p GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395d-5p GUUCUAUGCAAGCACUUCACGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395e-3p GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395e-5p GUUCCCUUCAAGCACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395f-3p GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395f-5p GUUACCUACAAGCACGUCUCGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395g-3p GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395g-5p GUUCUAUGCAAGCACUUCACGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395h-3p GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395h-5p GUUCCCUUCAAGCACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395i-3p GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395i-5p GUUCCCUACAAGCACUUCACGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395j-3p GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395j-5p GUUCCCUUCAAGCACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395k-3p GUGAAGUGUUUGAGGAAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395k-5p GUUUCCUUCAAGCACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395l-3p GUGAAGUGUUUGGAGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395l-5p GUUCCUUCCAAACACUUCACCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395m-3p GUGAAGUGUUUGGAGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395m-5p GUUCCUUUCAAACACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395n-3p GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395n-5p GUUCUCUACAAGCACUUCACGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395o-3p GUGAAGUGUUUGGGUGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395o-5p GUUCUCUUCAAGCACUUCACGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395p-3p GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR395p-5p GUUCCCUUCAAGCACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR396a-3p GUUCAAUAAAGCUGUGGGAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR396a-5p UUCCACAGCUUUCUUGAACUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR396b-3p GUUCAAUAAAGCUGUGGGAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR396b-5p UUCCACAGCUUUCUUGAACUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR396c UUCCACAGGCUUUCUUGAACUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR396d UUCCACAGGCUUUCUUGAACUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR396e-3p GGUCAAGAAAGCCGUGGGAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR396e-5p UUCCACAGCUUUCUUGAACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR396f-3p GGUCAAGAAAGCUGUGGGAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR396f-5p UUCCACAGCUUUCUUGAACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR396g-3p GUUCAAGAAAGCUGUGGAAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR396g-5p UCCCACAGCUUUAUUGAACUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR396h UCCCACAGCUUUAUUGAACUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR397a-3p UAGCCGUUAGCGCUCAUUAACU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR397a-5p UCAUUGAGCGCAGCGUUGAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR397b-3p CCAGCGCUGCACUCAAUUACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR397b-5p UCAUUGAGCGCAGCGUUGAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR398a-3p UGUGUUCUCAGGUCGCCCCCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR398a-5p GGGGCGAACUGAGAACACAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR398b-3p UGUGUUCUCAGGUCGCCCCCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR398b-5p GGGGCGGACUGGGAACACAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR399a-3p UGCCAAAGGAGAAUUGCCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR399a-5p GUGCGGUUCUCCUCUGGCACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR399b-3p UGCCAAAGGAGAGCUGUCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR399b-5p GUGCAGCUCUCCUCUGGCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR399c-3p UGCCAAAGGAGAAUUGCCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR399c-5p GGGUACGUCUCCUUUGGCACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR399d-3p UGCCAAAGGAGAGCUGCCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR399d-5p GUGUGGCUCUCCUCUGGCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR399e-3p UGCCAAAGGAGAGUUGCCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR399e-5p GGGCUUCUCUUUCUUGGCAGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR399f-3p UGCCAAAGGAAAUUUGCCCCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR399f-5p GGGCAACUUCUCCUUUGGCAGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR399g-3p UGCCAAAGGGGAUUUGCCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR399g-5p GGGCAACCCCCCGUUGGCAGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR399h-3p UGCCAAAGGAGAAUUGCCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR399h-5p GUGCAGUUCUCCUCUGGCACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR399i-3p UGCCAAAGGAGAGUUGCCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR399i-5p GUGCGGCUCUCCUCUGGCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR399j-3p UGCCAAAGGAGAGUUGCCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR399j-5p AGGCAGCUCUCCUCUGGCAGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR408a CUGCACUGCCUCUUCCCUGGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR408b-3p CUGCACUGCCUCUUCCCUGGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR408b-5p CAGGGACGAGGCAGAGCAUGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR444a UGCAGUUGUUGUCUCAAGCUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR444b UGCAGUUGUUGUCUCAAGCUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR482-3p UCUUCCUUGUUCCUCCCAUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR482-5p UGGGAGAUGAAGGAGCCUU 19 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR528a-3p CCUGUGCCUGCCUCUUCCAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR528a-5p UGGAAGGGGCAUGCAGAGGAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR528b-3p CCUGUGCCUGCCUCUUCCAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR528b-5p UGGAAGGGGCAUGCAGAGGAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR529-3p GCUGUACCCUCUCUCUUCUUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR529-5p AGAAGAGAGAGAGUACAGCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR827-3p UUAGAUGACCAUCAGCAAACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
zma-miR827-5p UUUGUUGGUGGUCAUUUAACC 21 0 0 0 0    0 0 0 0 0 0 0 0 0