Brachypodium miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  BDI08OBD03BDI04BDI09BDI06OBD02BDI05OBD01BDI02BDI03BDI17BDI01BDI18BDI19BDI15BDI16OBD04
bdi-miR1122 UAGAUACAUCCGUAUUUGGA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR1127 AACUACUCCCUCCGUCCGAUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR1135 UUUCGACAAGUAAUUCCGACCGGA 24 34 3 9 1    9 0 4 0 4 0 4 0 2 0 1 0 3 5 1 1 0
bdi-miR1139 GAGUAACAUACACUAGUAACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR1432 UUCAGGAGAGAUGACACCGACA 22 12,401 729 4,163 8    151 8 4,163 87 226 16 42 24 583 462 410 980 577 3,144 350 1,146 32
bdi-miR156a UGACAGAAGAGAGAGAGCACA 21 2 1 1 1    0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0
bdi-miR156b-3p GCUCACUUCUCUCUCUGUCACC 22 768 70 439 1    1 439 0 0 0 71 0 10 2 4 0 0 1 1 1 1 237
bdi-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 2,149,502 126,441 503,593 66    48,428 403 201,176 27,676 17,353 162 5,145 66 18,007 79,517 391,108 11,297 292,212 56,318 496,838 503,593 203
bdi-miR156c UGACAGAAGAGAGUGAGCAC 20 2,149,502 126,441 503,593 66    48,428 403 201,176 27,676 17,353 162 5,145 66 18,007 79,517 391,108 11,297 292,212 56,318 496,838 503,593 203
bdi-miR156d-3p GCUCACUGCUCUGUCUGUCACC 22 472 34 164 1    4 100 6 0 2 40 1 10 164 8 1 0 3 7 1 0 125
bdi-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 2,149,502 126,441 503,593 66    48,428 403 201,176 27,676 17,353 162 5,145 66 18,007 79,517 391,108 11,297 292,212 56,318 496,838 503,593 203
bdi-miR156e-3p GCUCACUUCUCUCUCUGUCAGC 22 557 93 516 1    0 516 0 0 0 3 0 33 0 0 0 0 0 2 0 1 2
bdi-miR156e-5p UGACAGAAGAGAGUGAGCAC 20 2,149,502 126,441 503,593 66    48,428 403 201,176 27,676 17,353 162 5,145 66 18,007 79,517 391,108 11,297 292,212 56,318 496,838 503,593 203
bdi-miR156f-3p GCUCACUGCUCUAUCUGUCAGC 22 1,864 266 1,685 1    7 1,685 0 0 0 28 0 111 0 0 0 0 0 0 2 1 30
bdi-miR156f-5p UGACAGAAGAGAGUGAGCAC 20 2,149,502 126,441 503,593 66    48,428 403 201,176 27,676 17,353 162 5,145 66 18,007 79,517 391,108 11,297 292,212 56,318 496,838 503,593 203
bdi-miR156g-3p GCUCACCCUCUCUCUGUCAGC 21 542 60 462 1    2 462 0 0 0 19 0 30 2 0 1 0 0 2 1 0 23
bdi-miR156g-5p UGACAGAAGAGAGUGAGCAC 20 2,149,502 126,441 503,593 66    48,428 403 201,176 27,676 17,353 162 5,145 66 18,007 79,517 391,108 11,297 292,212 56,318 496,838 503,593 203
bdi-miR156h-3p GCUCACUGCUCUUCCUGUCAUC 22 216 24 130 1    0 130 1 0 0 17 0 7 0 0 0 0 2 5 1 1 52
bdi-miR156h-5p UGACAGAAGAGAGUGAGCAC 20 2,149,502 126,441 503,593 66    48,428 403 201,176 27,676 17,353 162 5,145 66 18,007 79,517 391,108 11,297 292,212 56,318 496,838 503,593 203
bdi-miR156i-3p GCUCACCCUCUCUCUGUCAGC 21 542 60 462 1    2 462 0 0 0 19 0 30 2 0 1 0 0 2 1 0 23
bdi-miR156i-5p UGACAGAAGAGAGUGAGCAC 20 2,149,502 126,441 503,593 66    48,428 403 201,176 27,676 17,353 162 5,145 66 18,007 79,517 391,108 11,297 292,212 56,318 496,838 503,593 203
bdi-miR156j UGACAGAAGAGAGAGAGCAC 20 1,648 127 438 3    290 3 438 144 32 0 23 0 6 12 172 0 123 25 184 196 0
bdi-miR159a-3p CUUGGAUUGAAGGGAGCUCU 20 1,471 163 725 1    4 725 0 0 0 128 2 491 0 0 0 7 0 0 1 1 112
bdi-miR159a-5p AGCUCCCUUCGAUCCAAUC 19 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0
bdi-miR159b-3p.1 UUUGGAUUGAAGGGAGCUCUG 21 293,506 17,265 161,562 635    2,123 161,562 4,223 825 739 31,796 656 37,060 648 875 735 1,514 1,093 1,360 663 635 46,999
bdi-miR159b-3p.2 AUCCACCCCUUGCCGACCGCUG 22 32 2 7 1    6 5 2 0 2 2 1 1 2 0 0 7 1 1 1 1 0
bdi-miR159b-3p.3 UUUGCAUGACCGAGGAGCCGC 21 1,835 108 347 7    139 334 96 38 70 252 67 270 8 19 14 7 16 104 24 30 347
bdi-miR159b-5p.1 GAGCUCCUAUCAUUCCAAUGA 21 939 134 292 1    4 230 0 0 0 142 0 269 0 0 0 0 0 1 1 0 292
bdi-miR159b-5p.2 AAGGUCUGUCAGAAGGGUGAUAC 23 7,879 463 2,581 55    2,581 263 542 603 277 55 312 149 192 116 354 445 243 534 561 499 153
bdi-miR159b-5p.3 AGCUGCUUGUUCAUGGUUCCC 21 103 17 39 1    0 23 0 0 0 19 0 20 0 0 0 0 0 1 0 1 39
bdi-miR159c UUUGGUUUGAAGGGGGCUCUG 21 70 18 33 6    0 33 0 0 0 10 0 6 0 0 0 0 0 0 0 0 21
bdi-miR160a-3p GCGUGCGAGGAGCCAAGCAUG 21 97 9 20 2    4 0 0 0 5 0 2 0 20 4 9 15 12 7 12 7 0
bdi-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 6,330 372 1,787 7    116 1,787 46 64 49 806 76 1,424 132 112 16 45 7 133 21 25 1,471
bdi-miR160b-3p GCGUGCAAGGAGCCAAGCAUG 21 601 40 83 1    78 0 11 8 37 2 39 1 83 19 27 82 68 41 50 55 0
bdi-miR160b-5p UGCCUGGCUCCCUGUAUGCCA 21 6,330 372 1,787 7    116 1,787 46 64 49 806 76 1,424 132 112 16 45 7 133 21 25 1,471
bdi-miR160c-3p GCGUGCAAGGAGCCAAGCAUG 21 601 40 83 1    78 0 11 8 37 2 39 1 83 19 27 82 68 41 50 55 0
bdi-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 6,330 372 1,787 7    116 1,787 46 64 49 806 76 1,424 132 112 16 45 7 133 21 25 1,471
bdi-miR160d-3p GCGUGCACGGAGCCAAGCAUA 21 250 23 82 1    0 0 0 0 19 0 11 1 65 4 3 82 17 19 13 16 0
bdi-miR160d-5p UGCCUGGCUCCCUGUAUGCCA 21 6,330 372 1,787 7    116 1,787 46 64 49 806 76 1,424 132 112 16 45 7 133 21 25 1,471
bdi-miR160e-3p GCAUUGAGGGAGUCAUGCAGG 21 215 15 59 1    0 18 1 0 2 14 1 59 10 4 18 0 19 11 11 8 39
bdi-miR160e-5p UGCCUGGCUCCCUGAAUGCCA 21 32,466 1,910 14,324 4    4 4,553 326 77 31 9,317 32 3,246 43 177 67 15 22 177 26 29 14,324
bdi-miR160f UGCCUGGCUCCCUGUAUGCC 20 169 24 88 1    1 41 0 0 0 88 0 14 0 0 0 0 0 0 1 1 23
bdi-miR162 UCGAUAAACCUCUGCAUCCGG 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0
bdi-miR164a-3p CAUGUGCCCUUCUUCUCCACC 21 41 5 11 1    0 5 0 0 2 0 1 11 0 0 0 7 0 4 1 1 9
bdi-miR164a-5p UGGAGAAGCAGGGCACGUGCA 21 14,878 875 2,157 126    126 485 1,148 141 2,157 223 1,923 444 733 1,044 1,491 200 1,512 761 908 1,007 575
bdi-miR164b UGGAGAAGCAGGGCACGUGCA 21 14,878 875 2,157 126    126 485 1,148 141 2,157 223 1,923 444 733 1,044 1,491 200 1,512 761 908 1,007 575
bdi-miR164c-3p CAUGUGCGCUCCUUCUCCAGC 21 17 2 9 1    1 0 0 9 0 2 0 1 2 0 0 0 0 1 0 1 0
bdi-miR164c-5p UGGAGAAGCAGGGCACGUGCU 21 734 46 86 2    43 0 58 15 84 2 85 3 53 54 68 7 86 46 67 58 5
bdi-miR164e UGGAGAAGCAGGGCACGUGCA 21 14,878 875 2,157 126    126 485 1,148 141 2,157 223 1,923 444 733 1,044 1,491 200 1,512 761 908 1,007 575
bdi-miR164f UGGAGAAGAAGGGCACAUGCA 21 135 14 28 6    0 0 16 0 12 0 16 0 6 12 17 0 28 10 10 8 0
bdi-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 144,680 8,511 23,670 903    20,393 5,886 9,637 4,328 17,843 903 18,484 3,763 4,585 5,637 3,473 1,603 7,148 23,670 7,395 6,270 3,662
bdi-miR166a-5p GAAUGACGCCGGGUCUGAAAG 21 2,404 150 542 10    0 74 287 131 113 326 10 116 24 15 157 542 53 35 25 26 470
bdi-miR166b-3p UCGGACCAGGCUUCAUUCCCC 21 144,680 8,511 23,670 903    20,393 5,886 9,637 4,328 17,843 903 18,484 3,763 4,585 5,637 3,473 1,603 7,148 23,670 7,395 6,270 3,662
bdi-miR166b-5p GGAAUGUUGUCUGGCUCGGGG 21 577 36 100 5    100 20 28 42 26 0 26 6 95 8 74 30 36 34 21 26 5
bdi-miR166c-3p UCGGACCAGGCUUCAUUCCCC 21 144,680 8,511 23,670 903    20,393 5,886 9,637 4,328 17,843 903 18,484 3,763 4,585 5,637 3,473 1,603 7,148 23,670 7,395 6,270 3,662
bdi-miR166c-5p GGAAUGUUGUCUGGUUCAAGG 21 3,220 230 1,458 2    30 748 0 0 4 425 6 1,458 14 0 2 15 5 12 8 5 488
bdi-miR166d-3p UCGGACCAGGCUUCAUUCCCC 21 144,680 8,511 23,670 903    20,393 5,886 9,637 4,328 17,843 903 18,484 3,763 4,585 5,637 3,473 1,603 7,148 23,670 7,395 6,270 3,662
bdi-miR166d-5p GGAAUGUUGUCUGGUUGGAGA 21 621 44 99 6    0 15 58 99 50 31 44 85 6 0 73 0 7 31 48 47 27
bdi-miR166e-3p CUCGGACCAGGCUUCAUUCCC 21 253 17 46 4    34 15 46 0 31 0 17 7 8 4 8 15 8 40 8 7 5
bdi-miR166e-5p GGAAUGUUGUCUGGCUCGAGG 21 124 11 24 3    0 8 14 4 6 0 3 0 4 0 24 0 12 9 19 21 0
bdi-miR166f UCUCGGACCAGGCUUCAUUCC 21 51,179 3,011 39,707 50    39,707 1,422 678 383 4,988 50 894 105 245 285 85 638 210 902 275 203 109
bdi-miR166g-3p UGUGGUGAUCUCGGACCAGGC 21 4,174 261 798 82    0 214 798 150 305 92 482 310 144 266 226 193 82 273 145 129 365
bdi-miR166g-5p UCUGGUUCAAGGUCUCCACAU 21 2 1 1 1    0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0
bdi-miR166h-3p UCGGACCAGGCUUCAAUCCCU 21 12,481 780 3,864 41    0 79 212 403 2,753 41 3,864 346 528 462 113 200 396 2,034 498 404 148
bdi-miR166h-5p GGUUUGUUGUCUGGCUCGGGG 21 103 9 24 1    0 18 0 12 12 0 13 24 8 0 1 0 3 3 2 2 5
bdi-miR166i-3p UCGGACCAGGCUUCAUUCCCC 21 144,680 8,511 23,670 903    20,393 5,886 9,637 4,328 17,843 903 18,484 3,763 4,585 5,637 3,473 1,603 7,148 23,670 7,395 6,270 3,662
bdi-miR166i-5p GGCAUGUCGUGUGGCCCGAGA 21 11 3 7 1    0 0 0 0 0 0 1 0 2 0 0 7 0 0 0 1 0
bdi-miR166j UCGGACCAGGCUUCAUUCCUU 21 8,819 519 2,604 8    8 82 205 186 1,651 64 2,604 559 259 216 109 52 487 1,520 381 333 103
bdi-miR167a UGAAGCUGCCAGCAUGAUCUA 21 38,394 2,258 9,418 358    1,604 2,615 1,420 358 925 2,255 3,064 9,418 1,089 1,214 1,255 431 2,154 6,048 1,105 1,040 2,399
bdi-miR167b UGAAGCUGCCAGCAUGAUCUA 21 38,394 2,258 9,418 358    1,604 2,615 1,420 358 925 2,255 3,064 9,418 1,089 1,214 1,255 431 2,154 6,048 1,105 1,040 2,399
bdi-miR167c-3p GAUCAUGCUGUGCAGUUUCAUC 22 128 13 45 3    7 3 3 0 0 0 0 0 12 0 12 45 20 6 9 11 0
bdi-miR167c-5p UGAAGCUGCCAGCAUGAUCUGA 22 372,276 21,899 81,714 787    9,776 81,714 24,829 4,700 2,468 47,599 4,492 40,714 4,073 5,067 18,476 787 27,228 18,949 13,975 12,088 55,341
bdi-miR167d-3p AGAUCAUGUUGCAGCUUCAC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR167d-5p UGAAGCUGCCAGCAUGAUCUGA 22 372,276 21,899 81,714 787    9,776 81,714 24,829 4,700 2,468 47,599 4,492 40,714 4,073 5,067 18,476 787 27,228 18,949 13,975 12,088 55,341
bdi-miR167e-3p AGGUCAUGCUGGAGUUUCAUC 21 148 10 32 4    4 20 5 0 4 7 8 6 32 12 9 0 4 11 4 6 16
bdi-miR167e-5p UGAAGCUGCCAGCAUGAUCUGA 22 372,276 21,899 81,714 787    9,776 81,714 24,829 4,700 2,468 47,599 4,492 40,714 4,073 5,067 18,476 787 27,228 18,949 13,975 12,088 55,341
bdi-miR167f UGAAGCUGCCAGCAUGAUCUA 21 38,394 2,258 9,418 358    1,604 2,615 1,420 358 925 2,255 3,064 9,418 1,089 1,214 1,255 431 2,154 6,048 1,105 1,040 2,399
bdi-miR167g UGAAGCUGCCAGCAUGAUCUGA 22 372,276 21,899 81,714 787    9,776 81,714 24,829 4,700 2,468 47,599 4,492 40,714 4,073 5,067 18,476 787 27,228 18,949 13,975 12,088 55,341
bdi-miR168-3p CCCGCCUUGCACCAAGUGAAU 21 2,975 175 889 3    56 761 54 3 44 352 28 312 55 15 51 148 32 127 26 22 889
bdi-miR168-5p UCGCUUGGUGCAGAUCGGGAC 21 6,621,526 389,502 959,494 49,570    959,494 109,503 670,059 699,037 700,811 79,979 442,752 129,322 237,163 282,948 701,761 258,076 49,570 374,660 369,173 413,076 144,142
bdi-miR169a-3p GGCGAGUUGUUCUUGGCUACA 21 150 13 49 1    0 49 1 0 1 9 3 19 0 0 11 0 7 31 3 2 14
bdi-miR169a-5p CAGCCAAGGAUGACUUGCCGA 21 35,521 2,089 10,921 22    22 10,921 1,315 938 111 2,578 254 3,079 3,790 1,233 1,221 1,188 1,863 2,711 607 568 3,122
bdi-miR169b UAGCCAAGGAUGACUUGCCGG 21 985 62 537 2    15 20 20 22 22 17 157 537 43 42 12 0 21 16 3 2 36
bdi-miR169c-3p GGCAGGUUGUCCUUGGCUAC 20 5,562 371 2,959 7    2,959 23 84 345 224 7 155 0 36 35 185 67 112 869 249 212 0
bdi-miR169c-5p CAGCCAAGGAUGACUUGCCGG 21 27,123 1,595 4,959 522    4,959 3,488 1,207 1,393 1,088 542 531 879 2,630 2,766 934 1,202 1,209 1,618 575 522 1,580
bdi-miR169d UAGCCAAGAAUGACUUGCCUA 21 1,436 84 432 6    12 18 46 31 30 16 23 6 360 432 47 89 79 139 54 31 23
bdi-miR169e-3p GGCAGUCUCCUUGGCUAGC 19 196 13 52 1    10 51 7 5 5 3 11 4 28 0 6 0 1 52 3 3 7
bdi-miR169e-5p UAGCCAAGGAUGACUUGCCUG 21 7,431 437 2,655 11    287 92 97 230 113 33 58 11 692 2,655 145 1,381 259 1,187 103 70 18
bdi-miR169f CAGCCAAGGAUGACUUGCCGG 21 27,123 1,595 4,959 522    4,959 3,488 1,207 1,393 1,088 542 531 879 2,630 2,766 934 1,202 1,209 1,618 575 522 1,580
bdi-miR169g UAGCCAAGGAUGACUUGCCUG 21 7,431 437 2,655 11    287 92 97 230 113 33 58 11 692 2,655 145 1,381 259 1,187 103 70 18
bdi-miR169h-3p GGCAGUCACCUUGGCUAGC 19 284 17 42 1    1 13 11 17 15 2 27 9 36 42 24 22 2 25 14 17 7
bdi-miR169h-5p UAGCCAAGGAUGACUUGCCUA 21 4,839 285 1,773 22    48 87 39 106 40 85 22 70 1,773 1,087 210 549 210 183 126 115 89
bdi-miR169i CCAGCCAAGAAUGGCUUGCCUA 22 1,549 91 397 9    9 51 173 44 47 168 15 172 40 397 30 22 38 35 14 11 283
bdi-miR169j-3p UGGUCAAGCCUUCCUGACUAGG 22 1,373 81 248 18    24 28 79 74 35 60 18 27 38 39 234 30 224 248 77 56 82
bdi-miR169j-5p UAGCCAGGAAUGGCUUGCCUA 21 18 3 12 1    1 0 1 0 1 12 0 0 0 0 1 0 0 1 0 1 0
bdi-miR169k-3p GGGCAAGUCAGCCUGGCUACC 21 10 2 3 1    0 0 2 0 1 0 1 0 0 0 2 0 1 3 0 0 0
bdi-miR169k-5p UAGCCAAGGAUGAUUUGCCUGU 22 1,610 95 369 3    6 51 98 26 84 264 63 369 97 123 22 245 13 67 4 3 75
bdi-miR169l UAGCCAAGGAUGAAUUGCCGG 21 15 4 10 1    0 3 0 0 1 0 1 10 0 0 0 0 0 0 0 0 0
bdi-miR169m UAGCCAAGGAUGACUUGCCG 20 18,725 1,101 5,548 3    444 3 1,193 887 846 16 503 23 3,012 5,548 1,068 579 764 3,016 476 326 21
bdi-miR169n UAGCCAAGGAUGACUUGCCUA 21 4,839 285 1,773 22    48 87 39 106 40 85 22 70 1,773 1,087 210 549 210 183 126 115 89
bdi-miR171a UGAUUGAGCCGCGCCAAUAUC 21 182 20 55 1    2 26 0 0 0 41 0 55 8 0 0 0 0 2 1 1 46
bdi-miR171b UGAUUGAGCCGUGCCAAUAUC 21 48,618 2,860 17,505 138    152 9,039 257 138 279 8,172 418 17,505 1,105 193 352 186 551 1,753 328 258 7,932
bdi-miR171c-3p UGAUUGAGCCGUGCCAAUAUC 21 48,618 2,860 17,505 138    152 9,039 257 138 279 8,172 418 17,505 1,105 193 352 186 551 1,753 328 258 7,932
bdi-miR171c-5p CGGUAUUGGUGCGGUUCAAUC 21 93 8 43 1    0 18 1 1 4 10 7 43 0 0 0 0 2 3 0 2 2
bdi-miR171d-3p UGAUUGAGCCGUGCCAAUAUC 21 48,618 2,860 17,505 138    152 9,039 257 138 279 8,172 418 17,505 1,105 193 352 186 551 1,753 328 258 7,932
bdi-miR171d-5p UGUUGGCUCGACUCACUCAGA 21 709 47 262 3    0 117 3 21 21 59 43 262 24 12 4 0 5 44 13 8 73
bdi-miR171e UGAUUGAGCCGUGCCAAUAUC 21 48,618 2,860 17,505 138    152 9,039 257 138 279 8,172 418 17,505 1,105 193 352 186 551 1,753 328 258 7,932
bdi-miR171f UGAGCCGAACCAAUAUCACCC 21 10 2 3 1    1 3 0 0 0 2 0 0 2 0 0 0 0 2 0 0 0
bdi-miR172a-3p AGAAUCUUGAUGAUGCUGCAU 21 293,123 17,243 39,834 78    78 345 35,304 13,717 28,954 1,644 16,726 1,980 34,665 11,451 27,978 11,379 39,834 38,212 13,168 15,485 2,203
bdi-miR172a-5p GCAGCACCACCAAGAUUCACA 21 39 4 9 1    0 5 2 0 1 3 2 9 0 0 0 0 1 4 2 3 7
bdi-miR172b GGAAUCUUGAUGAUGCUGCAU 21 4,243 250 1,381 1    1 5 22 79 320 10 314 98 565 451 47 1,381 176 365 166 222 21
bdi-miR172d AGAAUCCUGAUGAUGCUGCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR1878-3p AUUUGUAGUGUUCAGAUUGAGUUU 24 238 18 76 1    4 10 2 0 4 45 5 76 0 4 0 0 3 17 1 1 66
bdi-miR1878-5p ACUUAGUCUGAACACUAUAAAAAA 24 37 5 12 2    0 0 9 0 0 0 3 0 2 0 3 0 2 12 4 2 0
bdi-miR2118a UUUCCGAUGCCUCCCAUUCCUA 22 7 7 7 7    0 0 0 0 0 0 0 7 0 0 0 0 0 0 0 0 0
bdi-miR2118b UUCCUGAUGCCUCCCAUUCCUA 22 18 6 13 2    0 3 0 0 0 2 0 13 0 0 0 0 0 0 0 0 0
bdi-miR2275a UUUGGUUUCCUCCAAUGUCUCA 22 218 31 154 1    0 13 1 0 0 14 0 154 0 0 0 0 0 0 1 1 34
bdi-miR2275b UUCAGUUUCUUCUAAUAUCUCA 22 26 13 23 3    0 3 0 0 0 0 0 23 0 0 0 0 0 0 0 0 0
bdi-miR2275c UUUGGUUUCCUCCAAUAUCUCA 22 52 7 39 1    0 3 0 0 1 3 0 39 0 0 0 0 0 3 1 0 2
bdi-miR319a UGAGGGAGCUUUCUUCUGUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR319b-3p UUGGACUGAAGGGUGCUCCCU 21 32,131 1,890 11,649 3    141 10,952 6 31 264 5,316 151 11,649 36 39 3 82 7 71 28 23 3,332
bdi-miR319b-5p AGAGCUCUCUUCAGUCCACUC 21 9 2 4 1    0 0 0 0 2 0 0 0 4 0 0 0 0 1 1 1 0
bdi-miR390a-3p CGCUAUCUAUCCUGAGCUCCA 21 57 7 16 1    0 15 0 0 1 5 0 16 4 0 0 0 0 1 0 1 14
bdi-miR390a-5p AAGCUCAGGAGGGAUAGCGCC 21 2,833 167 678 7    22 143 7 7 80 74 66 89 678 104 133 423 155 302 156 239 155
bdi-miR393a UCCAAAGGGAUCGCAUUGAUC 21 3,717 219 1,240 14    14 41 404 291 178 64 84 66 340 77 158 1,240 137 295 114 95 119
bdi-miR393b-3p UCAGUGCAAUCCCUUUGGAAU 21 9,786 652 3,551 13    0 485 85 18 34 3,551 15 2,266 32 181 22 0 39 71 14 13 2,960
bdi-miR393b-5p UCCAAAGGGAUCGCAUUGAUC 21 3,717 219 1,240 14    14 41 404 291 178 64 84 66 340 77 158 1,240 137 295 114 95 119
bdi-miR394 UUGGCAUUCUGUCCACCUCC 20 4,694 293 2,103 3    31 546 23 35 71 718 19 1,013 6 27 13 0 3 61 11 14 2,103
bdi-miR395a UGAAGUGUUUGGGGGAACUC 20 2,745 161 1,279 2    120 151 61 37 30 328 14 510 8 35 2 7 7 8 95 53 1,279
bdi-miR395b UGAAGUGUUUGGGGGAACUC 20 2,745 161 1,279 2    120 151 61 37 30 328 14 510 8 35 2 7 7 8 95 53 1,279
bdi-miR395c-3p UGAAGUGUUUGGGGGAACUC 20 2,745 161 1,279 2    120 151 61 37 30 328 14 510 8 35 2 7 7 8 95 53 1,279
bdi-miR395c-5p GUUCCCUGCAAGCACUUCAUG 21 8 2 3 1    3 0 1 0 0 2 0 0 0 0 0 0 0 1 0 1 0
bdi-miR395d-3p AAGUGUUUGGGGAACUCUAGG 21 346 35 137 1    0 13 9 0 4 76 0 95 2 4 0 0 5 0 0 1 137
bdi-miR395d-5p UGGGGUUCCCUCCAAACACUUCA 23 74 8 33 1    0 3 0 0 0 5 0 33 2 0 1 0 1 0 1 1 27
bdi-miR395e-3p UGAAGUGUUUGGGGGAACUC 20 2,745 161 1,279 2    120 151 61 37 30 328 14 510 8 35 2 7 7 8 95 53 1,279
bdi-miR395e-5p GUUCUCCUCAAAUCACUUCAGU 22 40 10 18 5    0 5 0 0 0 7 0 10 0 0 0 0 0 0 0 0 18
bdi-miR395f-3p UGAAGUGUUUGGGGGAACUC 20 2,745 161 1,279 2    120 151 61 37 30 328 14 510 8 35 2 7 7 8 95 53 1,279
bdi-miR395f-5p GUUCCCUUCAAACACUUUACG 21 2 2 2 2    0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0
bdi-miR395g-3p UGAAGUGUUUGGGGGAACUC 20 2,745 161 1,279 2    120 151 61 37 30 328 14 510 8 35 2 7 7 8 95 53 1,279
bdi-miR395g-5p GUUUCCUGCAAACACUUCACG 21 6 1 2 1    0 0 1 0 0 0 0 0 0 0 0 0 0 1 1 1 2
bdi-miR395h-3p UGAAGUGUUUGGGGGAACUC 20 2,745 161 1,279 2    120 151 61 37 30 328 14 510 8 35 2 7 7 8 95 53 1,279
bdi-miR395h-5p GUUCCCUGCAAGCACUUCACG 21 44 4 11 1    5 0 11 0 1 2 0 0 6 0 1 7 1 0 5 5 0
bdi-miR395j-3p UGAAGUGUUUGGGGGAACUC 20 2,745 161 1,279 2    120 151 61 37 30 328 14 510 8 35 2 7 7 8 95 53 1,279
bdi-miR395j-5p GUUUCCCGCAAGCACUUCACG 21 3 1 1 1    0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 1 0
bdi-miR395k-3p UGAAGUGUUUGGGGGAACUC 20 2,745 161 1,279 2    120 151 61 37 30 328 14 510 8 35 2 7 7 8 95 53 1,279
bdi-miR395k-5p GUUCCCUGCAAGCACUUCAUG 21 8 2 3 1    3 0 1 0 0 2 0 0 0 0 0 0 0 1 0 1 0
bdi-miR395l-3p UGAAGUGUUUGGGGGAACUC 20 2,745 161 1,279 2    120 151 61 37 30 328 14 510 8 35 2 7 7 8 95 53 1,279
bdi-miR395l-5p GUUCCCUGCAAGCACUUCACG 21 44 4 11 1    5 0 11 0 1 2 0 0 6 0 1 7 1 0 5 5 0
bdi-miR395m UGAAGUGUUUGGGGGAACUC 20 2,745 161 1,279 2    120 151 61 37 30 328 14 510 8 35 2 7 7 8 95 53 1,279
bdi-miR395n-3p UGAAGUGUUUGGGGGAACUC 20 2,745 161 1,279 2    120 151 61 37 30 328 14 510 8 35 2 7 7 8 95 53 1,279
bdi-miR395n-5p GUUCCCUGCAAGCACUUCACC 21 2 1 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0
bdi-miR395o-3p UGAAGUGUUUGGGGGAACUC 20 2,745 161 1,279 2    120 151 61 37 30 328 14 510 8 35 2 7 7 8 95 53 1,279
bdi-miR395o-5p AUUCCCUACAAGCACUUCACA 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0
bdi-miR395p-3p UGAAGUGUUUGGAGGAACUC 20 106 9 34 1    4 3 6 0 1 22 1 24 4 0 0 0 0 2 2 3 34
bdi-miR395p-5p GUUUCCUGCAAGCACUUCACG 21 2 2 2 2    0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR395q UGAAGUGUUUGGGGGAACUC 20 2,745 161 1,279 2    120 151 61 37 30 328 14 510 8 35 2 7 7 8 95 53 1,279
bdi-miR396a-3p GUUCAAGAAAGUCCUUGGAAA 21 2,454 164 1,280 3    26 365 6 43 49 347 49 1,280 20 0 3 0 10 3 8 6 239
bdi-miR396a-5p UCCACAGGCUUUCUUGAACUG 21 165,306 9,724 57,899 297    565 18,727 1,403 1,007 794 57,899 843 39,643 1,249 9,567 389 297 610 2,250 400 338 29,325
bdi-miR396b-3p GUUCAAGAAAGCCCAUGGAAA 21 45 5 14 1    0 10 0 0 0 12 1 14 0 0 1 0 3 1 2 1 0
bdi-miR396b-5p UCCACAGGCUUUCUUGAACUG 21 165,306 9,724 57,899 297    565 18,727 1,403 1,007 794 57,899 843 39,643 1,249 9,567 389 297 610 2,250 400 338 29,325
bdi-miR396c-3p GUUCAAUAAAGCUGUGGGAAA 21 162 12 63 1    7 28 1 14 10 5 7 63 0 0 1 0 3 3 1 3 16
bdi-miR396c-5p UUCCACAGCUUUCUUGAACUG 21 855 50 214 2    106 69 17 14 69 83 58 214 49 58 2 7 7 32 11 7 52
bdi-miR396d-3p GUUCAAUAAAGCUGUGGGAAA 21 162 12 63 1    7 28 1 14 10 5 7 63 0 0 1 0 3 3 1 3 16
bdi-miR396d-5p UUCCACAGCUUUCUUGAACUG 21 855 50 214 2    106 69 17 14 69 83 58 214 49 58 2 7 7 32 11 7 52
bdi-miR396e-3p GGUCAAGAAAGCUGUGGGAAG 21 424 28 68 2    0 33 2 14 24 16 23 68 6 0 31 15 60 16 54 41 21
bdi-miR396e-5p UUCCACAGCUUUCUUGAACUU 21 6,284 449 2,160 4    0 590 20 0 9 2,160 20 1,648 140 65 6 0 10 42 6 4 1,564
bdi-miR397a UCAUUGAGUGCAGCGUUGAUG 21 28 7 11 3    0 10 0 0 0 3 0 4 0 0 0 0 0 0 0 0 11
bdi-miR397b-3p CUUCGACCCUGCACCCAAUCA 21 13 3 8 1    0 8 0 0 0 0 0 3 0 0 0 0 0 0 1 1 0
bdi-miR397b-5p AUUGAGUGCAGCGUUGAUGAA 21 61,717 4,114 32,473 1    210 25,641 1 0 4 2,117 3 32,473 2 19 3 0 5 4 218 242 775
bdi-miR398a UGUGUUCUCAGGUCGCCCCUG 21 137 34 92 10    0 92 0 0 0 10 0 10 0 0 0 0 0 0 0 0 25
bdi-miR398b CAGGAGUGUCACUGAGAACACA 22 9 5 8 1    0 8 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0
bdi-miR399a UGCCAAAGGAGAAUUACCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR399b UGCCAAAGGAGAAUUGCCCUG 21 24 3 7 1    0 5 1 0 0 7 0 1 0 0 0 0 1 0 0 4 5
bdi-miR399c UGCCAAAGGAGAAUUGCCCUG 21 24 3 7 1    0 5 1 0 0 7 0 1 0 0 0 0 1 0 0 4 5
bdi-miR399d UGCCAAAGGAGAUUUGCCCGG 21 313 21 133 1    5 133 4 9 0 40 3 36 2 12 2 0 1 4 2 19 41
bdi-miR408-3p CUGCACUGCCUCUUCCCUGGC 21 999 143 866 1    1 866 0 0 0 28 0 65 0 0 0 0 0 0 2 5 32
bdi-miR408-5p CAGGGAUGGAGCAGAGCAUGG 21 825 59 396 1    9 89 1 0 4 0 2 43 2 0 5 7 2 1 255 396 9
bdi-miR437 GAACUUAGAGAAGUUUGACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR444a UUGCUGCCUCAAGCUUGCUGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR444b UGCAGUUGCUGCCUCAAGCUU 21 5,285 311 1,043 6    614 8 234 38 113 7 82 6 1,043 524 278 482 607 777 271 194 7
bdi-miR444c UGCAGUUGUUGUCUCAAGCUU 21 1,305 77 382 7    61 10 60 37 22 17 12 7 57 73 80 126 175 382 85 87 14
bdi-miR444d UGCAGUUGUUGUCUCAAGCUU 21 1,305 77 382 7    61 10 60 37 22 17 12 7 57 73 80 126 175 382 85 87 14
bdi-miR5049-3p CAAGUAAUAUGGAUCGGAGGAAGU 24 16 2 4 1    2 0 0 0 4 0 3 0 0 0 0 0 2 2 1 2 0
bdi-miR5049-5p UCCUUCCGACCCAUAUUACUUGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5054 UCCCCACGGUCGGCGCCA 18 1,671 104 743 2    4 743 12 2 19 161 25 194 22 250 23 37 0 8 2 5 164
bdi-miR5055 UCUCGCUGCUGAGCUCGGCGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5056 AGGAAGAACCGGUAAUAAGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5057 AAAUUUCAAAUCAUUUUGACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5058 AACAGUUGAGGGAUGAAAAACA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5059 CGGCCUGGGCAGCACCACCA 20 1 1 1 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5060 CGGCUAGCUAGAGACCGCCAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5061 UCUGUUCUGUCCUGCUCGGUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5062a UGAACCUUGGGGAAAAGCCGCCU 23 14 2 4 1    0 0 0 0 0 0 0 0 0 4 1 0 2 4 2 1 0
bdi-miR5063 UCCACUGGAAAAGGCUUUUGCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5064 CGAAUUUGUCCAUAGCAUCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5065 UAGGCAAUUCACUUAUACACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5066 AAGUGUAUAAGUGGAGUGCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5067 UCAGCGACAACUAAUAUGGAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5068 AUCGGGUAGAGCGGGUAUGGGUAU 24 2 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0
bdi-miR5069 UAGGUUAUUGAUUUGACCAAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5070 AACUAAGUAGGGUCAGAGGGU 21 7 7 7 7    0 0 0 0 0 0 0 0 0 0 0 7 0 0 0 0 0
bdi-miR5163a-3p UUAGGUAUUUCAGGUUAGGUG 21 14,846 873 4,183 1    26 2,285 122 1 67 4,183 66 3,255 10 8 192 52 373 392 173 154 3,487
bdi-miR5163a-5p CCUAGCCUAAAAUAUUUAAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5163b-3p UAGAUAUUUCAGGUUGUGUGGA 22 74,971 4,410 8,136 154    5,824 5,510 5,682 2,274 2,930 6,495 2,385 8,136 354 154 4,339 1,611 6,790 7,168 3,922 4,280 7,117
bdi-miR5163b-5p CACCCAACUGAAAUAUUUAAA 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0
bdi-miR5164 CGCAACUUUGUCUAGAUACGC 21 26 4 11 1    0 3 0 0 0 7 1 11 0 0 0 0 1 1 0 0 2
bdi-miR5165-3p CCUACCUUGAGCCAAAGAUAU 21 6 2 3 1    0 0 0 0 0 0 1 3 2 0 0 0 0 0 0 0 0
bdi-miR5165-5p AUCUUGGGCUCUAGGUAGGUU 21 210 15 62 3    6 8 10 0 12 0 14 3 14 0 11 15 62 19 18 13 5
bdi-miR5166 UGCCCACCAGGGUUCGAUCCA 21 49 12 20 5    0 8 0 5 0 0 0 20 0 0 0 0 0 0 0 0 16
bdi-miR5167a-3p CCAAUGACACCCAUAGUGGAA 21 7 2 3 1    0 3 0 0 1 0 0 3 0 0 0 0 0 0 0 0 0
bdi-miR5167a-5p CCACUUUGGGUGUCAUUGGUA 21 468 39 165 1    5 94 1 0 1 117 1 165 0 0 0 0 1 1 1 1 80
bdi-miR5167b-3p UGUGAAUUGCCUUAACGAGAGC 22 3 3 3 3    0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5167b-5p UCUAGUUAAGGUAAUUUAACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5169a UUUGACCAAGUUUGUAGAACA 21 616 44 175 2    30 5 175 28 39 7 50 6 0 0 25 0 58 140 22 29 2
bdi-miR5169b UUUGACCAAGUUUGUAGAACA 21 616 44 175 2    30 5 175 28 39 7 50 6 0 0 25 0 58 140 22 29 2
bdi-miR5170 UCAUCAAGUUGAGUGACCGUA 21 190 15 25 2    4 0 25 0 7 22 2 24 10 0 11 0 19 25 11 14 16
bdi-miR5171a ACUUAAUAUGGGACGGAAGAA 21 2 1 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0
bdi-miR5171b ACUUAAUAUGGGACGGAAGAA 21 2 1 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0
bdi-miR5172-3p UGAUCUACUAGCUCCUCGGCA 21 300 19 46 5    21 46 13 0 20 19 9 29 22 15 5 15 12 21 11 10 32
bdi-miR5172-5p CGAGGAGCUAGUAGAUCGGGA 21 349 23 116 3    116 3 12 9 59 0 19 3 16 4 16 7 17 24 24 20 0
bdi-miR5173-3p UGCAUCUGUAUAUACGAGAAG 21 181 13 49 2    3 5 19 9 6 7 4 9 0 0 15 0 26 49 15 12 2
bdi-miR5173-5p UCUCGUAUAUGCGGAUGUACC 21 534 31 92 8    12 20 60 20 20 47 21 68 16 15 14 45 18 92 19 8 39
bdi-miR5174a CUCCGUUCCAUAAAGAUUGGC 21 37 9 16 3    0 8 0 0 0 3 0 10 0 0 0 0 0 0 0 0 16
bdi-miR5174b-3p CAACCUUUAUGGAACGGAGGG 21 2 1 1 1    0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0
bdi-miR5174b-5p CCUCUGUUCCAUAAAGAUUGG 21 19 2 8 1    8 0 2 0 1 0 1 3 0 0 0 0 0 1 0 1 2
bdi-miR5174c-3p CAAUUUUGCGUGGAACUGAGGGAG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5174c-5p UCCCUCCGUUCUAUGAAGAUUGGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5174d-3p CAAUCUUUAUGGAACGGAGAGAGU 24 13 2 4 1    0 0 1 0 1 0 1 0 0 0 1 0 2 4 1 2 0
bdi-miR5174d-5p UCCCUCCGUUUCAUAAAGAUUGGC 24 17 4 9 2    0 3 0 0 0 2 0 3 0 0 0 0 0 0 0 0 9
bdi-miR5174e-3p.1 CAACCUUUAUGGAACGGAGGG 21 2 1 1 1    0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0
bdi-miR5174e-3p.2 UUUAUGGAACGGAGGGAGUAG 21 5 1 1 1    0 0 0 0 0 0 0 1 0 0 0 0 1 1 1 1 0
bdi-miR5174e-5p.1 CCUCUGUUCCAUAAAGAUUGG 21 19 2 8 1    8 0 2 0 1 0 1 3 0 0 0 0 0 1 0 1 2
bdi-miR5174e-5p.2 UACUCCCUCUGUUCCAUAAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5174f CCUCCGUUUCAUAAAGGUUGG 21 731 122 259 1    0 125 0 0 0 140 0 259 0 0 0 0 0 1 1 0 205
bdi-miR5175a AAGAAUUUAGGAACGGAGGGA 21 656 39 126 5    39 10 26 11 36 5 39 20 45 23 62 126 85 22 46 50 11
bdi-miR5175b CCUCUGUUCCUAAAUUCUUGU 21 3 3 3 3    0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0
bdi-miR5176-3p UGUGAUGAUGUGGCAUAGAAU 21 3,122 184 443 35    114 319 260 237 60 356 61 443 38 35 135 45 168 241 119 92 399
bdi-miR5176-5p UAUGCCAUGUCGUCACAUAUC 21 191 14 45 5    0 10 17 0 19 9 9 16 8 0 9 7 16 45 5 7 14
bdi-miR5177 UGAGGUUGUAAAACAGACAGU 21 27 3 11 1    0 0 11 0 0 0 3 1 2 0 1 0 2 4 2 1 0
bdi-miR5178-3p UCUGACCGGUGGGCCUGAGCG 21 304 20 74 7    16 15 38 74 17 7 20 13 0 15 19 0 32 7 13 7 11
bdi-miR5178-5p CUUGGGACCGCCGGUCAGAGC 21 8 4 6 2    0 0 0 0 0 2 0 6 0 0 0 0 0 0 0 0 0
bdi-miR5179 UUUUGCUCAAGACCGCGCAAC 21 2,411 142 388 18    18 41 47 53 388 24 346 254 320 208 38 200 126 176 51 62 59
bdi-miR5180a UAAGUGUCUCAGUUUUGAACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5180b UAAGUGUCUCAGUUUUGAACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5181a-3p CGGCACUUAUUAUGGAUCAGA 21 105 8 27 1    0 3 18 0 5 16 5 13 0 4 1 0 3 6 2 2 27
bdi-miR5181a-5p UGAUCCAUAAUAAGUGUCAGG 21 65 6 21 1    0 5 2 0 0 21 1 13 0 0 3 0 4 2 2 1 11
bdi-miR5181b UCCGAUCCAUAAUAAGUGUCG 21 7 1 2 1    0 0 0 0 0 2 0 1 0 0 0 0 0 1 1 0 2
bdi-miR5181c-3p ACUUCUUAUGGAUUGUAGGGA 21 277 17 56 1    13 56 17 7 4 31 5 56 2 0 1 22 2 5 3 1 52
bdi-miR5181c-5p CCUCCGGUCCACAAUAAGUGU 21 20 7 14 3    0 3 0 0 0 0 0 3 0 0 0 0 0 0 0 0 14
bdi-miR5181d ACUUAUUAUGGACCGGAGGGA 21 46 3 10 1    3 0 1 0 2 3 1 10 4 0 2 7 2 1 5 3 2
bdi-miR5181e CGACACUUACUGUGGCUCGGA 21 687 43 135 3    17 3 112 135 29 0 39 7 101 104 9 52 13 4 33 22 7
bdi-miR5182 UGAUGAUCUUGGAACACGUGC 21 901 90 278 1    0 174 0 0 0 278 1 184 2 0 1 0 2 3 1 0 255
bdi-miR5183 UAUUUGGACAAAUUUGAGUCA 21 13 2 3 1    0 3 1 0 0 2 1 3 0 0 0 0 0 1 1 1 0
bdi-miR5184 UUCUAACAUUAUGCACAUCUA 21 7 2 5 1    0 0 0 0 0 5 0 1 0 0 0 0 0 1 0 0 0
bdi-miR5185a-3p UUUGAGAAUUGAACUAGAAGC 21 470 28 97 5    89 5 97 56 12 17 19 10 14 15 7 37 23 46 7 9 7
bdi-miR5185a-5p UUCUAGUUCAUUUUUCAAAUC 21 8 3 4 2    0 0 0 0 0 2 0 4 0 0 0 0 0 0 0 0 2
bdi-miR5185b-3p UUUGAGAAUUGAACUAGAAGC 21 470 28 97 5    89 5 97 56 12 17 19 10 14 15 7 37 23 46 7 9 7
bdi-miR5185b-5p UUCUAGUUCAUUUUUCAAAUC 21 8 3 4 2    0 0 0 0 0 2 0 4 0 0 0 0 0 0 0 0 2
bdi-miR5185c-3p UUUGAGAAUUGAACUAGAAGC 21 470 28 97 5    89 5 97 56 12 17 19 10 14 15 7 37 23 46 7 9 7
bdi-miR5185c-5p UUCUAGUUCAUUUUUCAAAUC 21 8 3 4 2    0 0 0 0 0 2 0 4 0 0 0 0 0 0 0 0 2
bdi-miR5185d-3p UUUGAGAAUUGAACUAGAAGC 21 470 28 97 5    89 5 97 56 12 17 19 10 14 15 7 37 23 46 7 9 7
bdi-miR5185d-5p UUCUAGUUCAUUUUUCAAAUC 21 8 3 4 2    0 0 0 0 0 2 0 4 0 0 0 0 0 0 0 0 2
bdi-miR5185e-3p UUUGAGAAUUGAACUAGAAGC 21 470 28 97 5    89 5 97 56 12 17 19 10 14 15 7 37 23 46 7 9 7
bdi-miR5185e-5p UUCUAGUUCAUUUUUCAAAUC 21 8 3 4 2    0 0 0 0 0 2 0 4 0 0 0 0 0 0 0 0 2
bdi-miR5185f-3p UUUGAGAAUUGAACUAGAAGC 21 470 28 97 5    89 5 97 56 12 17 19 10 14 15 7 37 23 46 7 9 7
bdi-miR5185f-5p UUCUAGUUCAUUUUUCAAAUC 21 8 3 4 2    0 0 0 0 0 2 0 4 0 0 0 0 0 0 0 0 2
bdi-miR5185g-3p UUUGAGAAUUGAACUAGAAGC 21 470 28 97 5    89 5 97 56 12 17 19 10 14 15 7 37 23 46 7 9 7
bdi-miR5185g-5p UUCUAGUUCAUUUUUCAAAUC 21 8 3 4 2    0 0 0 0 0 2 0 4 0 0 0 0 0 0 0 0 2
bdi-miR5185h-3p UUUGAGAAUUGAACUAGAAGC 21 470 28 97 5    89 5 97 56 12 17 19 10 14 15 7 37 23 46 7 9 7
bdi-miR5185h-5p UUCUAGUUCAUUUUUCAAAUC 21 8 3 4 2    0 0 0 0 0 2 0 4 0 0 0 0 0 0 0 0 2
bdi-miR5185i-3p UUUGAGAAUUGAACUAGAAGC 21 470 28 97 5    89 5 97 56 12 17 19 10 14 15 7 37 23 46 7 9 7
bdi-miR5185i-5p UUCUAGUUCAUUUUUCAAAUC 21 8 3 4 2    0 0 0 0 0 2 0 4 0 0 0 0 0 0 0 0 2
bdi-miR5185j-3p UUUGAGAAUUGAACUAGAAGC 21 470 28 97 5    89 5 97 56 12 17 19 10 14 15 7 37 23 46 7 9 7
bdi-miR5185j-5p UUCUAGUUCAUUUUUCAAAUC 21 8 3 4 2    0 0 0 0 0 2 0 4 0 0 0 0 0 0 0 0 2
bdi-miR5185k-3p UUUGAGAAUUGAACUAGAAGC 21 470 28 97 5    89 5 97 56 12 17 19 10 14 15 7 37 23 46 7 9 7
bdi-miR5185k-5p UUCUAGUUCAUUUUUCAAAUC 21 8 3 4 2    0 0 0 0 0 2 0 4 0 0 0 0 0 0 0 0 2
bdi-miR5185l-3p UUUGGAGAUUGACUUAGAAGC 21 382 32 114 1    0 84 7 0 2 114 1 85 2 0 0 0 1 2 1 1 82
bdi-miR5185l-5p UUCUAAGUCAAUCUCUAAAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5185m-3p UUUGAAAAUUGAACUAGAAGC 21 77 6 21 1    3 0 21 0 2 5 2 3 10 0 2 7 5 13 1 1 2
bdi-miR5185m-5p UUCUAGUUCAUUUUUCGAAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5198 GGGGAAAAGAGAUUGAGGGAG 21 2 1 1 1    0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0
bdi-miR5199 UGUUCAUACGGUUGAUAGCAC 21 162 12 43 1    2 33 5 0 0 26 1 43 2 0 2 0 5 5 1 1 36
bdi-miR5200a-3p UGUAGAUACUCCCUAAGGCUU 21 1,817 130 1,447 1    0 5 48 14 122 0 112 1 18 8 2 0 11 1,447 13 11 5
bdi-miR5200a-5p GCCUUAGGGAAUAUCUACACU 21 11 6 10 1    0 0 0 0 0 0 1 0 0 0 0 0 0 10 0 0 0
bdi-miR5200b-3p UGUAGAUACUCCCUAAGGCUU 21 1,817 130 1,447 1    0 5 48 14 122 0 112 1 18 8 2 0 11 1,447 13 11 5
bdi-miR5200b-5p GCCUUAGAGAGUAUCUACACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5200c UGUAGAUACUCUCUAAGGCUU 21 6 3 5 1    0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 1 0
bdi-miR5201-3p AGGGCGAGGCAAAUGAUCAAA 21 102 7 18 2    3 5 5 5 11 0 3 3 6 4 12 0 7 7 11 18 2
bdi-miR5201-5p UGAUCAUUUGCCCCGUCUUGU 21 63 16 23 11    0 13 0 0 0 16 0 23 0 0 0 0 0 0 0 0 11
bdi-miR5202 UUACGUGAGUUAAAUCGUCGA 21 1,037 80 227 22    72 0 227 162 67 0 53 0 22 31 31 59 63 125 61 64 0
bdi-miR528-3p CCUGUGCCUGCCUCUUCCAUU 21 30 5 13 1    4 0 0 0 1 0 0 13 0 0 0 0 0 0 5 5 2
bdi-miR528-5p UGGAAGGGGCAUGCAGAGGAG 21 135,527 7,972 81,506 14    4,934 618 752 150 3,247 14 216 303 316 270 793 1,373 605 301 40,056 81,506 73
bdi-miR5281a UCUUAUAAAUAGGAACGGAGG 21 107 6 22 1    5 3 20 2 4 2 3 6 6 8 3 22 7 5 1 5 5
bdi-miR5281b UCUUAUAAAUAGGAACGGAGG 21 107 6 22 1    5 3 20 2 4 2 3 6 6 8 3 22 7 5 1 5 5
bdi-miR529-3p GCUGUACCCUCUCUCUUCUUC 21 351 44 121 1    0 74 0 0 2 41 0 96 8 0 0 0 0 8 0 1 121
bdi-miR529-5p AGAAGAGAGAGAGUACAGCCU 21 1,773 136 321 1    12 0 82 0 92 0 183 1 40 73 309 111 321 140 152 257 0
bdi-miR530a UGCAUUUGCACCUGCACCUAC 21 5 1 2 1    0 0 0 0 0 0 0 1 2 0 0 0 0 1 1 0 0
bdi-miR530b UGCAUUUGCACCUGCACCUAC 21 5 1 2 1    0 0 0 0 0 0 0 1 2 0 0 0 0 1 1 0 0
bdi-miR531 GAUGCUCGCCGGAGCAGCGUGCUG 24 2,884 170 479 12    110 18 180 214 84 12 115 59 190 96 258 67 479 436 257 270 39
bdi-miR7707-3p UUUGAUCGAUGUAUGGCUGAACGG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7707-5p GUUCAGCCAUACAUCGAUCGAAGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7708a-3p UGUAAUGGUACUGAACAAAGACGC 24 22 2 5 1    4 0 2 0 5 0 2 0 0 0 1 0 2 3 1 2 0
bdi-miR7708a-5p GUUUUUCCUCAGUACCGUUACAAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7708b-3p AAAUGGCCCGAGAAUUGUAAUGGU 24 65 5 18 1    0 10 1 0 4 7 2 7 0 0 2 7 2 3 1 1 18
bdi-miR7708b-5p CAUUACAAUUCUUGGGACAUUUGC 24 3 3 3 3    0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7709-3p UGUGCCUAGUCGUACUUUGAU 21 31 3 7 1    0 3 0 0 1 5 0 6 6 0 0 0 1 1 1 0 7
bdi-miR7709-5p UAAAGUAUGACUAGGCACACG 21 6 2 2 1    0 0 0 0 0 0 2 0 0 0 0 0 2 1 0 1 0
bdi-miR7710-3p AUUGAUGUCACAAACUAUAGUAGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7710-5p UACUACAGAUCGUGAUGUCAACUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7711-3p.1 AGAUUGUUAAAGAGGCCAAGUAUU 24 939 72 252 2    2 0 51 0 40 2 16 3 6 4 166 0 252 216 95 86 0
bdi-miR7711-3p.3 UAUGAGUCGAUUUCUCUUAUGGCU 24 464 27 84 7    39 18 40 17 35 36 19 17 45 12 18 7 25 84 9 11 32
bdi-miR7711-3p.4 UAUCCUAGCCAUAAAAUUCAGUAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7711-5p.1 UACUUAGCCUCUUUGACAAUCUUG 24 71 12 31 1    0 31 1 0 0 9 0 10 0 0 0 0 0 2 0 0 18
bdi-miR7711-5p.2 AUGAUAGAAUUUCUAAAUUAGAAG 24 20 4 8 1    0 0 6 0 0 0 0 0 0 0 0 0 4 8 1 1 0
bdi-miR7711-5p.3 CCAUAAGUGAAAUCAACUCAUUCU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7711-5p.4 UCUGAAUUUUAUGACCAAGAUAAC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7712-3p UUAUUGUGGUAACUUUAAGAUGGC 24 6 2 3 1    0 3 0 0 0 0 1 0 0 0 0 0 1 0 1 0 0
bdi-miR7712-5p UAGAGCUCUGAAGUUACCACCCAC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7713-3p UUGAGACUGGCAGCAUUAGCAAGC 24 9 2 5 1    0 0 0 5 0 0 0 0 0 0 0 0 0 0 1 1 2
bdi-miR7713-5p UAGGAAUUGAUGGAACAGCUCACA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7714-3p CUAAUAUGUAUCGAAGGGAGUAGC 24 3 2 2 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 2
bdi-miR7714-5p UAUUUUCUCGGAUCAAUAUUACUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7715-3p UAAGAAAACCCACCUUUGAUG 21 2 2 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2
bdi-miR7715-5p UCAAAGAUGGGAUUUCUGAAC 21 41 5 16 1    2 0 6 0 1 7 0 3 2 0 1 0 0 3 0 0 16
bdi-miR7716-3p UUCGUUCUUCUCCAGUAAUUGACC 24 2 2 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2
bdi-miR7716-5p UCAGUUGCUAGAGAAGAACGAAAC 24 488 38 116 1    33 0 79 5 116 0 51 1 10 12 33 0 29 66 29 24 0
bdi-miR7717a-3p GAUGGAUACGAUUGUCGACUGAGA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7717a-5p UCAUUGAGAUUCGUGUAAAUUAA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7717b-3p AACUAUUUUUAAGUUGACCGAGAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7717b-5p UCUAAGACGACUGAGAAAUAACUA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7717c-3p UUAGUUGACUGAGAAAUAGACGGU 24 39 5 11 1    0 0 11 7 0 0 1 0 0 0 4 0 5 7 2 2 0
bdi-miR7717c-5p UUGCUAUUUCUUGGGCGACUGAGA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7718-3p AUCGCCUUAGACGAAUAAAUGAGG 24 72 6 23 1    0 8 1 0 1 12 0 13 2 0 1 0 3 5 2 1 23
bdi-miR7718-5p UCAUUUAUUCGUCCAUGGCGAUGG 24 19 3 6 1    0 5 1 0 0 0 1 6 0 0 0 0 0 1 0 0 5
bdi-miR7719-3p UAGAAGCAUAUAUGGCGAAGA 21 11 2 4 1    0 0 0 0 0 2 1 4 0 0 1 0 1 1 0 1 0
bdi-miR7719-5p UCCGCCAUACAUGUUUCUAUC 21 34 3 12 1    0 3 1 0 1 2 0 1 12 4 0 0 2 5 1 2 0
bdi-miR7720-3p UUUUACACAUGAUUUGGGUUGGAC 24 9 2 4 1    0 0 1 0 4 0 1 1 0 0 0 0 0 2 0 0 0
bdi-miR7720-5p UCGAAAUUGAUCGUGCGGAGAAGC 24 10 1 3 1    0 0 0 0 1 0 1 3 0 0 1 0 1 1 1 1 0
bdi-miR7721-3p AAAGUUUGGCAUAGAAUUCAAUGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7721-5p ACGGGAUUUUAUAACGGACUUUGG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7722-3p GAAGGGUAUCGGGAUGAGAGG 21 4 1 2 1    2 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0
bdi-miR7722-5p UCUCCUCCCGGUACCCUUCUU 21 3 3 3 3    0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7723a-3p GAGGGCCAAGGUAGUUGUUUCACA 24 316 24 67 1    4 0 22 0 21 0 10 1 2 12 48 22 67 57 26 24 0
bdi-miR7723a-5p UGAAACAACUAUCUUGGCCUUCUC 24 94 9 29 2    7 0 4 0 6 3 3 0 0 12 10 0 15 29 3 2 0
bdi-miR7723b-3p AUGAAGGUAGUAGUUUCAAAAUGG 24 60 6 13 2    0 8 5 0 2 0 0 6 0 0 4 0 11 13 2 2 7
bdi-miR7723b-5p AUUUUGAUACUACUACCUUCAUCA 24 2 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0
bdi-miR7724a-3p UUGGCCCACAUUGACAUGUUCACC 24 5 1 2 1    0 0 0 0 0 2 0 1 0 0 0 0 1 0 1 0 0
bdi-miR7724a-5p UGAACAUGUACAUGCUGGCCAACC 24 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
bdi-miR7724b-3p UUGGCCCACAUUGACAUGUUCACC 24 5 1 2 1    0 0 0 0 0 2 0 1 0 0 0 0 1 0 1 0 0
bdi-miR7724b-5p UGAACAUGUACAUGCUGGCCAACC 24 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
bdi-miR7725a-3p UGCAAACAAUGUGAUUUCGUCAAG 24 9 2 3 1    0 0 2 0 0 3 0 0 0 0 1 0 1 1 1 0 0
bdi-miR7725a-5p UGACGAGAUCACAUCGUUUGCACA 24 8 2 3 1    0 3 0 0 0 0 0 3 0 0 1 0 0 1 0 0 0
bdi-miR7725b-3p.1 UGAAAACCAUAUUCCUAGCUC 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
bdi-miR7725b-3p.2 CAAAUAAGAGGAGACGAGACAUAG 24 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
bdi-miR7725b-5p.1 ACUAGGGAGAUGGUUUUCGCU 21 23 6 10 3    0 3 0 0 0 10 0 3 0 0 0 0 0 0 0 0 7
bdi-miR7725b-5p.2 AUGCUCCACCUCAUAUUUGAC 21 2 2 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2
bdi-miR7726a-3p UGCGAAUCUGUCACCGUUGUCCCC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7726a-5p UGAUGAUGGUACGGACGUCGCGGU 24 24 3 11 1    2 0 0 4 11 2 2 1 2 0 0 0 0 0 0 0 0
bdi-miR7726b-3p UGCGAUACGUCACUUCACCGAAAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7726b-5p UUUGAUGACAUGACGUACGGCGGC 24 15 2 6 1    0 0 1 0 1 0 0 6 0 0 2 0 1 1 0 1 2
bdi-miR7727-3p CCAAGUCGAUUGGAACUAAUGAGC 24 5 5 5 5    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5
bdi-miR7727-5p UGAUUAGUUUCAGUUGGUCUGGGC 24 4 1 1 1    0 0 1 0 1 0 0 0 0 0 0 0 1 1 0 0 0
bdi-miR7728-3p AAAUACACUCAAUUCAAGCAG 21 2 1 1 1    0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0
bdi-miR7728-5p UGCUCGGAUUGAGUGUAUUUU 21 351 23 71 2    2 71 10 0 2 48 7 62 6 0 3 30 8 35 5 5 57
bdi-miR7729a-3p AGCAAUGGUGGUGGUUUGGAGGAG 24 1 1 1 1    0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7729a-5p UGUUUUCAUAGGCCAUGUAGAGC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7729b-3p AGCAAUGGUGGUGGUUUGGAGGAG 24 1 1 1 1    0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7729b-5p UGUUUUCAUAGGCCAUGUAGAGC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7730-3p AACUUUCUCCCGCAGCUGUUCUGU 24 37 4 15 1    0 0 0 0 0 2 0 1 8 4 1 15 0 2 1 1 2
bdi-miR7730-5p AGAACAGCCACGGUUGAAAGUUAU 24 26 3 7 2    0 0 2 0 0 0 3 0 0 0 3 7 3 3 2 3 0
bdi-miR7731-3p AGGUUUGCUCUGGACUUUGGAAUC 24 1,624 102 410 3    14 352 4 18 4 357 3 408 6 0 5 15 5 10 6 7 410
bdi-miR7731-5p UUCCAAAUUCCUGAGCAAACAUAU 24 15 2 4 1    0 3 0 0 0 3 1 4 0 0 1 0 1 1 0 1 0
bdi-miR7732-3p GAUCGAGAUCGUGGAGGAACC 21 103 10 28 1    0 28 0 0 1 14 2 27 2 0 0 0 0 1 1 2 25
bdi-miR7732-5p UUCCUCCAAGAUCUCGGAGACUC 23 158 11 43 2    7 0 43 0 14 7 22 10 8 8 3 7 8 9 5 2 5
bdi-miR7733-3p CCUGCGUUGGCGAAGGCGAGAAGC 24 29 3 8 1    0 3 8 1 1 0 1 0 0 4 4 0 1 2 3 1 0
bdi-miR7733-5p UUCUCGCCAUUGCCAAACCAGGGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7734-3p UUAACCUAGUCACAUUCAACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7734-5p UUGAACGUGACUGGGUUAACG 21 22 2 6 1    6 3 0 0 1 2 1 3 0 0 1 0 1 1 0 1 2
bdi-miR7735-3p CCGGUCGGAGCCAAGAGACGCGGC 24 27 2 7 1    6 0 0 0 1 2 3 1 2 0 1 7 0 1 1 2 0
bdi-miR7735-5p UUGUUUUCCUUCUGCACUCCCGGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7736-3p UGACAUAUCUGAUGGUAAAGG 21 48 5 14 1    1 13 0 0 0 5 1 11 0 0 0 0 1 1 1 0 14
bdi-miR7736-5p UUUACUAUCUGGGAUGUCACA 21 33 5 12 1    0 3 0 0 0 12 0 6 0 0 0 0 0 1 1 1 9
bdi-miR7737-3p ACUUGAGACGGACUGUAUUAAAAA 24 4 2 3 1    0 0 1 0 0 0 0 0 0 0 0 0 0 3 0 0 0
bdi-miR7737-5p UUUCGGUCAAUGUAUUUCAAGCAG 24 4 1 1 1    0 0 0 0 1 0 0 0 0 0 1 0 1 1 0 0 0
bdi-miR7738-3p GUGCUUGACAGACGACUCUGG 21 921 61 437 5    5 163 0 30 7 66 6 437 10 12 5 0 11 10 7 6 146
bdi-miR7738-5p AGAGUCGUUUGUCAAGCUCGG 21 194 14 59 4    0 10 4 0 22 0 7 16 16 12 5 59 11 12 9 6 5
bdi-miR7739-3p UUGAGUCUGAGAAGUAUUUCUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7739-5p AGAUGCGUCGAAGCGGACUGGAUC 24 4 2 3 1    0 0 0 0 1 3 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7740-3p GAGACAGAGGUUGUUCGGAUG 21 14 3 5 1    0 5 0 0 0 3 0 3 0 0 1 0 0 0 0 0 2
bdi-miR7740-5p UUUGAACAACCUCGGUCUCAU 21 8 2 2 1    0 0 0 0 0 2 0 0 0 0 1 0 2 1 0 0 2
bdi-miR7741-3p.1 AGAUCUUCCAUGAGUAAAAAU 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
bdi-miR7741-3p.2 UGCAUGUGGAACUUCCAGAUC 21 195 14 40 2    19 38 10 17 6 16 2 40 0 0 4 0 8 3 6 3 23
bdi-miR7741-5p.1 UUUUAAUUGUGGAAGCUCUUG 21 1,330 78 378 2    45 220 17 3 7 378 2 296 10 8 2 15 5 4 3 3 312
bdi-miR7741-5p.2 UCUUGAAGUUUCGCAUGCAGU 21 67 8 26 1    0 26 1 0 0 3 0 23 0 0 1 0 1 3 0 0 9
bdi-miR7742-3p UGUGUGUUCGAGUGAAUGAGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7742-5p UCAUUCGCUCAUUCACACAGU 21 3 3 3 3    0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7743-3p UUUGAACUUUUGUAUUGGAUCUUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7743-5p AGCAUCUACUGAUAGUUUGACUGC 24 12 2 4 1    0 0 2 0 0 0 0 4 0 0 1 0 1 2 1 1 0
bdi-miR7744-3p CAUCGACAACUUUUGCCAUCCUUA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7744-5p AGGAUGGCAAGAUUUAUCGAUGGG 24 713 59 269 1    0 112 2 0 4 119 1 184 0 0 3 0 9 7 2 1 269
bdi-miR7745-3p UUGUUGUUACUUAAGUCUUGGUAC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7745-5p AGUAAGGCUUUAGUAACAAGAGAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7746-3p UUCUAUUGGAACUCUUAAUCUAUG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7746-5p AUAGACUAAGAGUUCCAACAGAAG 24 1 1 1 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7747-3p AUCCUAUAACAAAACAAACUGAUC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7747-5p AUCAGAUUGUUUUGUUGUAGGAUG 24 20 5 9 1    0 3 0 0 0 7 0 1 0 0 0 0 0 0 0 0 9
bdi-miR7748a-3p AAUAUGUUUUCUAUUGUUGGACGG 24 2 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0
bdi-miR7748a-5p AUCCAACAACAAGGGACGUGUUAG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7748b-3p UUGGUCAAAGAAAAUCUAAUACGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7748b-5p AUGUUAGGAUUCGGUUGACCAAGC 24 102 7 17 2    13 0 4 8 5 5 2 17 2 0 7 0 11 10 5 2 11
bdi-miR7749-3p UGGAAUGGGCGCUCUCAGGGAAGC 24 2 2 2 2    0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0
bdi-miR7749-5p AUCGUCGAGGGCGGAGAUUGCGGC 24 12 2 4 1    1 0 0 0 2 0 1 0 4 0 1 0 1 0 1 1 0
bdi-miR7750-3p CAUGGUCGGCAAUGAUACAGACGA 24 45 5 17 1    0 0 1 0 17 0 8 0 2 0 2 0 2 6 3 4 0
bdi-miR7750-5p AUCUGAAUCAUUGCCGACCAUGCA 24 38 4 11 1    0 0 10 0 0 0 1 1 4 0 3 0 11 3 2 3 0
bdi-miR7751-3p UUUGGUGCACCCGGCUGGAGAUGG 24 1 1 1 1    1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7751-5p AUCUUCCUCGUGGACAAGCGGUAG 24 18 3 7 1    0 0 3 0 2 0 0 0 0 4 0 7 0 0 1 1 0
bdi-miR7752-3p AAAAUGAUAGGUUGGAAGAACACGC 25 4 2 3 1    0 3 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
bdi-miR7752-5p AUGCUCUUCCCACUGUCAUUUUCC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7753-3p UGAGCAAGGGAGAAGACAUGG 21 31 4 15 1    0 0 1 0 0 0 0 0 0 0 3 15 7 3 1 1 0
bdi-miR7753-5p AUGUCUUCUUCCUUGCUCAUC 21 2 2 2 2    0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7754-3p UUCUCUCGGCUAAGGAACUGC 21 783 131 292 1    0 220 0 0 0 162 0 106 2 0 1 0 0 0 0 0 292
bdi-miR7754-5p AUGUUCUCUCGGCUGAGGAAC 21 8 1 2 1    0 0 2 0 0 0 0 0 0 0 0 0 1 1 1 1 2
bdi-miR7755-3p UCAAUUUACGGUGUAGAAUUG 21 58 10 17 1    0 15 0 0 0 14 0 17 0 0 0 0 2 0 0 1 9
bdi-miR7755-5p AUUCCACACUGUAAAUUGAAU 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
bdi-miR7756-3p UGGAGAUGUUGGCAUUGAAUUGGC 24 29 3 7 1    1 0 0 0 1 0 5 3 0 0 3 7 4 0 3 2 0
bdi-miR7756-5p CAAUGCAAUGCCAAGUCUUUCGA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7757-3p.1 GGUAGUUGAAUGUUUUGUUUA 21 51 7 23 1    1 23 0 0 1 3 0 9 0 0 0 0 0 3 0 0 11
bdi-miR7757-3p.2 AGAUAACUUGAUAUGUAAGUG 21 106 8 30 2    3 5 8 0 5 19 2 10 4 0 2 0 5 30 3 3 7
bdi-miR7757-5p.1 CACAAAACCUUCAGCUACCCA 21 4,670 275 1,269 9    53 56 230 9 303 38 224 47 1,269 200 205 260 136 1,008 225 313 94
bdi-miR7757-5p.2 CUUCCAUAUCAAAUCAUCUCU 21 88 10 33 1    0 10 2 0 1 33 0 4 0 0 0 0 1 6 0 1 30
bdi-miR7758-3p UAGCGGUCAACUAACUGUAGUGGC 24 73 6 32 1    32 0 2 4 7 3 3 0 6 4 0 7 1 0 2 2 0
bdi-miR7758-5p CACUACCGUUAGUUGACCGUUAAG 24 3 1 1 1    0 0 0 0 0 0 0 1 0 0 0 0 1 0 1 0 0
bdi-miR7759-3p GGCUUAUGCCGACGUGGCUAC 21 4 1 1 1    1 0 0 0 1 0 0 1 0 0 0 0 0 1 0 0 0
bdi-miR7759-5p CAGCCACGUCGGCAUAAGCGAG 22 38 4 9 2    2 0 0 0 0 0 3 3 0 4 2 0 5 5 3 2 9
bdi-miR7760-3p GGCUUUGCUCGGAGUGCUGUGGC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7760-5p CAGCGGACAGAAUGGAGCAAGCAG 24 12 2 2 1    2 0 1 0 2 0 2 0 2 0 0 0 0 1 1 1 0
bdi-miR7761-3p UCUUGAUCAAGAGACGGCUCUGGC 24 150 13 34 2    34 3 25 16 16 2 12 0 0 0 7 0 7 15 7 6 0
bdi-miR7761-5p CAGUGCCGUCUCUUCCUCAAGUUC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7762-3p CUCGGAAUUUGGUCAUCAACUGGC 24 160 13 65 1    65 41 1 0 14 2 6 4 0 0 1 0 2 17 3 4 0
bdi-miR7762-5p CAGUUGAUGACCAAGUUCUCGAGA 24 26 7 13 2    4 13 0 0 0 2 0 7 0 0 0 0 0 0 0 0 0
bdi-miR7763-3p AUUCCCGUACGUCAAGAUUGC 21 2,843 203 794 1    1 651 0 0 5 656 6 703 2 0 1 7 3 10 2 2 794
bdi-miR7763-5p AAUCUUGAUGUGCGGGGAUAG 21 717 51 181 9    49 181 0 0 21 62 12 159 16 12 11 0 14 60 15 9 96
bdi-miR7764-3p AAAUAGAUCUUGGCGUUAUGGG 22 47 6 15 1    5 15 0 0 1 7 1 10 0 0 0 0 1 0 0 0 7
bdi-miR7764-5p CAUAACCUAGAUCUGUAUCA 20 3 2 2 1    0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0
bdi-miR7765-3p UUACAAGAAGUUGGACUAAAAUGC 24 3 2 2 1    0 0 0 0 0 2 0 0 0 0 0 0 0 1 0 0 0
bdi-miR7765-5p CAUUUUAGUCCAACAAGUUGCAA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7766-3p CGAGGCUGACUGGGACUAAGCGGC 24 16 2 8 1    1 0 2 0 2 0 8 0 0 0 1 0 1 1 0 0 0
bdi-miR7766-5p CCAACUGGGCCAGUCGGCCUGGGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7767-3p AGGAGCAAGCAGCUUGAAGGU 21 6 1 2 1    0 0 0 0 1 0 1 1 0 0 0 0 0 0 0 1 2
bdi-miR7767-5p CCCCAAGCUGAGAGCUCUCCC 21 14 2 4 1    0 3 1 0 2 2 1 1 0 4 0 0 0 0 0 0 0
bdi-miR7768a-3p CGGCGCCGUCCUCGACCGGGAG 22 34 3 8 1    3 8 4 4 1 0 0 1 4 4 0 0 4 1 0 0 0
bdi-miR7768a-5p CCCGGUCGAGGACGGCCCCGC 21 3,736 220 686 22    238 82 382 98 595 22 686 91 123 150 205 282 58 373 141 139 71
bdi-miR7768b-3p CGGCGCCGUCCUCGACCGGGAG 22 34 3 8 1    3 8 4 4 1 0 0 1 4 4 0 0 4 1 0 0 0
bdi-miR7768b-5p CCCGGUCGAGGACGGCCCCGC 21 3,736 220 686 22    238 82 382 98 595 22 686 91 123 150 205 282 58 373 141 139 71
bdi-miR7769-3p UGUCAUGUUGGCACUGAUGGG 21 87 5 20 1    2 20 7 2 2 16 1 1 2 4 1 7 4 6 4 1 7
bdi-miR7769-5p CCGUCAGUGCCAACAUGCCAG 21 5 3 3 2    0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2
bdi-miR7770-3p UCUAGACGGGCCUUCAAAGAG 21 269 21 48 3    0 43 37 0 19 29 7 30 12 0 10 0 13 14 4 3 48
bdi-miR7770-5p CCUUGAAAGCCUGUCUAGACA 21 21 3 6 1    0 5 1 0 0 2 0 6 0 0 0 0 1 1 0 0 5
bdi-miR7771-3p AUGUGUACUAUAGAAGUCAAGGGU 24 7 1 2 1    2 0 0 0 1 0 1 1 0 0 1 0 1 0 0 0 0
bdi-miR7771-5p CCUUGACUCCUAUAGUACACAUUC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7772-3p AGAUCUCCAUGAACUGAGAAACGG 24 27 4 8 2    2 0 3 0 0 0 0 0 0 0 5 0 8 3 3 3 0
bdi-miR7772-5p CGCUUUUCGGUCCGUGGAGACGCA 24 21 3 6 1    2 0 1 6 4 0 4 0 0 0 0 0 1 2 0 1 0
bdi-miR7773-3p UUUUUCCUUCGGCUGACACGU 21 117 10 28 1    0 8 3 0 5 28 1 27 12 4 3 0 4 4 0 0 18
bdi-miR7773-5p CGGGUCAACGAAGGAAAAAUU 21 6 1 2 1    0 0 0 0 1 0 1 0 0 0 2 0 1 1 0 0 0
bdi-miR7774-3p GAGCGAACGUUAAAUUCCGUGGGG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7774-5p ACUAUGGUCUGUGAGGAUGGCAAC 24 79 6 11 3    3 0 4 0 10 3 8 4 0 0 4 7 11 9 6 5 5
bdi-miR7775-3p CUAGUGCUUAGACAAAACCCGGUU 24 8 2 3 1    0 0 0 0 0 0 2 0 2 0 0 0 0 3 0 1 0
bdi-miR7775-5p ACCGGUUUAUUCUGAAGCACCAGU 24 9 2 3 1    0 0 0 0 0 3 0 1 0 0 1 0 1 1 0 0 2
bdi-miR7776-3p.1 AAAGAUAUCAGAGGGCAACG 20 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
bdi-miR7776-3p.2 UUGAUAAUGGGUUGAAUGCGC 21 356 24 100 1    0 28 10 0 1 90 2 57 2 8 9 30 4 11 3 1 100
bdi-miR7776-5p.1 CUUGCCCUCUGAUAUCUUGG 20 5 5 5 5    0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7776-5p.2 ACAUUCAACUCAUUAUUAAUG 21 1 1 1 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7777-3p.1 UUGUUCCACCCAACAGAAGAU 21 5 1 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 2
bdi-miR7777-3p.2 UGAGAUGGUGUCUGUUGAAGG 21 7 1 3 1    0 3 0 0 1 0 0 0 0 0 0 0 1 1 1 0 0
bdi-miR7777-5p.1 CUUUGGUUGGGUAGAACUACC 21 2 2 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2
bdi-miR7777-5p.2 UCUGACAAACACCAUCGCAAC 21 2 2 2 2    0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0
bdi-miR7778-3p CUGCGCCGCGACUUUCGGACGAG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7778-5p GAGCAUCGUGUCGGCGUGCGCGGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7779-3p UUCUCGAUCUGUAGACCGAUCUAG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7779-5p GAGGUCAUUGUCAGACAUGGGAAG 24 52 9 18 2    2 18 0 0 0 9 0 14 0 0 0 0 0 0 2 0 7
bdi-miR7780-3p GUAGGGACCUUGCUGAAGACGUUU 24 116 10 30 2    21 0 6 14 10 0 4 0 4 0 6 30 2 8 6 5 0
bdi-miR7780-5p GAUAAUUUAGUGGCCUUCCUACUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7781-3p CAUGUCUGUAGUCAGAAAAAUCAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7781-5p GAUUUUUCUGACGACGGACAUGGC 24 7 1 2 1    0 0 0 0 0 0 0 0 2 0 1 0 0 1 2 1 0
bdi-miR7782-3p ACCUGCUCUGAUACCAUGUUGUGA 24 131,495 7,735 25,569 534    6,235 8,084 14,023 1,851 8,381 16,661 7,029 17,838 885 2,462 1,881 534 3,582 12,766 2,055 1,659 25,569
bdi-miR7782-5p GCGGCAUGGUAUUAGAGCAAGUUG 24 1,925 128 458 7    53 0 79 7 338 7 246 10 123 8 178 45 100 458 147 126 0
bdi-miR7783-3p AGCUCUGAUACCAUGUGGAUGAGA 24 91,040 5,355 41,839 35    395 77 3,370 543 1,842 35 2,056 115 41,839 9,740 4,284 5,025 9,311 6,107 3,028 3,175 98
bdi-miR7783-5p GCGUCUACUUGGUAUCCAAGCUUA 24 35 4 16 1    3 0 2 0 2 0 2 0 16 0 2 0 1 4 2 1 0
bdi-miR7784a-3p CAUAGACUUAUGAGACGAGUACAU 24 6 1 2 1    0 0 0 0 0 0 0 0 0 0 1 0 1 1 1 2 0
bdi-miR7784a-5p GUACAUGAACUUAUAAGACGAGUA 24 5 1 1 1    0 0 1 0 0 0 1 0 0 0 1 0 1 0 0 1 0
bdi-miR7784b-3p CAUAGACUUAUGAGACGAGUACAU 24 6 1 2 1    0 0 0 0 0 0 0 0 0 0 1 0 1 1 1 2 0
bdi-miR7784b-5p GUACAUGAACUUAUAAGACGAGUA 24 5 1 1 1    0 0 1 0 0 0 1 0 0 0 1 0 1 0 0 1 0
bdi-miR7785-3p UUUCUUCUGUGAGCCUGACUGAGC 24 4 2 3 1    0 3 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0
bdi-miR7785-5p GUAGAAUGGGUGAUGGGAGAAGGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7786-3p UGCACAAACUGUGGAGUAGUCGGC 24 26 3 5 1    0 0 4 5 2 0 4 0 2 0 1 0 1 4 1 2 0
bdi-miR7786-5p GUCUAUGUCUAUGUCUGUGCACGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7787-3p UGCUUCGGUCUGUGCUUGGGCACG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7787-5p GUGCUCGUCCACAAGAGAAGCAGG 24 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0
bdi-miR827-3p UUAGAUGACCAUCAGCAAACA 21 1,172 73 646 11    11 20 21 0 30 14 12 70 16 39 24 22 16 59 142 646 30
bdi-miR827-5p UUUUGUUGGUUGUCAUCUAACC 22 344 29 126 1    7 59 2 0 1 126 1 114 0 0 2 0 0 4 1 11 16
bdi-miR845 UGCUCUGAUACCAAUUGUUGG 21 1,187 297 1,152 3    0 1,152 0 0 0 3 0 27 0 0 0 0 0 0 0 0 5
bdi-miR9480a UAUGUGAGGGUGGUAACUGAA 21 3,313 195 700 18    212 365 103 28 142 204 98 700 18 46 178 37 281 226 190 179 306
bdi-miR9480b UAUGUGAGGGUGGUAACUGAA 21 3,313 195 700 18    212 365 103 28 142 204 98 700 18 46 178 37 281 226 190 179 306
bdi-miR9481a UCAGUCGGAUUUCUCACCUUCGAA 24 770 385 761 9    0 761 0 0 0 0 0 9 0 0 0 0 0 0 0 0 0
bdi-miR9481b UCAGUCGGAUUUCUCACCUUC 21 146 49 140 2    0 140 0 0 0 0 0 4 0 0 0 0 0 0 0 0 2
bdi-miR9482 CCUUUGGGGAAGAAGGGAAAC 21 692 43 350 2    350 5 25 17 165 5 17 11 4 4 3 22 0 14 24 24 2
bdi-miR9483a UUGAACUGUUUCCUCUGAAGUUCC 24 633 317 623 10    0 623 0 0 0 0 0 10 0 0 0 0 0 0 0 0 0
bdi-miR9483b UUGAACUGUUUCCUCUGAAGUUCC 24 633 317 623 10    0 623 0 0 0 0 0 10 0 0 0 0 0 0 0 0 0
bdi-miR9484 UAGUGCAGGGAGAAGUCGGUC 21 548 34 163 2    33 13 31 33 21 0 20 4 18 81 16 163 35 35 19 24 2
bdi-miR9485 UUAUGACGUGUAGGAGUUGCA 21 549 32 72 6    17 8 33 31 39 19 35 37 6 35 17 7 42 72 70 67 14
bdi-miR9486a AUGCUUUCAAGGGAUUAGAGGUUC 24 507 32 166 1    75 166 2 0 22 33 11 66 8 4 1 37 5 16 7 13 41
bdi-miR9486b UAAGUGAUUAGAGGUUCCAGU 21 236 16 43 3    7 18 7 0 4 31 3 32 4 4 9 0 31 17 14 12 43
bdi-miR9487 CCUUGUUCGAUUGCAAGAUGA 21 348 35 114 1    0 71 1 0 1 114 0 112 2 0 0 0 3 3 0 2 39
bdi-miR9488 UGAGGGCUAGGCUUUUAUGUAA 22 343 21 61 3    3 0 20 18 15 9 20 9 4 12 37 15 60 61 30 19 11
bdi-miR9489 UCAGCUCCACGGACUUGGUGA 21 291 19 95 1    1 56 0 5 7 36 7 95 4 4 1 0 2 5 1 1 66
bdi-miR9490 AGGCCACACCCUAAUGGUCGUGCG 24 220 20 110 1    3 110 3 0 2 24 0 26 6 0 0 0 4 7 1 0 34
bdi-miR9491 UGGUAUGUUACCUCUGAUCAG 21 139 14 53 1    0 10 4 0 0 19 0 16 53 0 1 15 4 0 1 0 16
bdi-miR9492 UAUCUACUCUGUCAUGGUAUC 21 124 10 50 1    1 0 3 8 0 50 0 23 2 0 1 7 1 3 1 1 23
bdi-miR9493 AAGAAUUAUGAAACGAAGGGAGUA 24 119 12 37 2    2 0 5 0 5 0 2 0 0 0 13 37 26 10 9 10 0
bdi-miR9494 UUCAUCACCUUCGUCUCCGUC 21 112 11 41 1    0 13 2 0 2 14 2 19 0 12 0 0 1 6 0 0 41
bdi-miR9495 UGAAAAAUGCCUCUGGACGUG 21 103 9 28 1    7 15 11 0 1 28 1 20 2 0 1 0 0 2 0 1 14
bdi-miR9496 CUGGUUGGGCUUAGAUGGGUCC 22 86 7 41 1    3 41 0 0 1 14 0 3 2 0 3 0 1 1 1 2 14
bdi-miR9497 UUUCUGAAUACAUGGUGUAUC 21 71 18 30 5    0 8 0 0 0 28 0 30 0 0 0 0 0 0 0 0 5
bdi-miR9498 GACCGUCAAGUGGUUGUUGAG 21 43 5 20 1    0 3 1 0 0 3 0 20 2 0 0 7 1 0 1 0 5
bdi-miR9499 CCCUCGUCGACGCGGCAGCUC 21 278 20 105 1    12 0 29 105 10 0 8 0 36 27 3 37 3 1 3 2 2