Arabidopsis miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  Leaf_WT_1Leaf_WT_2Leaf_WT_3Sprn_Mock_1_2_10Sprn_Mock_2_2_10Sprn_Mock_3_2_10EV_Mock_1_2_10EV_Mock_2_2_10EV_Mock_3_2_10EV_27EV_28EV_29EV_30EV_31EV_32EVs_B05_Rep1EVs_B05_Rep2EVs_B05_Rep3EVs_MOCK_Rep1EVs_MOCK_Rep2EVs_MOCK_Rep3TOTAL_B05_Rep3TOTAL_B05_Rep1TOTAL_B05_Rep2TOTAL_MOCK_Rep1TOTAL_MOCK_Rep2TOTAL_MOCK_Rep3
ath-miR10515 ACCCCGAUGGUUAUCCUCACC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR156a-3p GCUCACUGCUCUUUCUGUCAGA 22 53 6 17 1    2 5 10 1 0 0 0 0 0 17 0 0 1 3 0 0 0 0 0 0 0 5 0 9 0 0 0
ath-miR156a-5p UGACAGAAGAGAGUGAGCAC 20 63,088 2,337 8,303 38    5,824 4,164 3,252 234 66 494 45 74 97 8,303 276 650 6,690 749 1,258 1,453 915 128 1,126 813 38 2,932 4,640 2,560 5,458 5,636 5,213
ath-miR156b-3p UGCUCACCUCUCUUUCUGUCAGU 23 7,642 294 1,144 1    251 913 622 1 33 288 0 50 26 841 41 573 520 237 713 1,144 35 43 442 104 102 157 20 71 127 92 196
ath-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 63,088 2,337 8,303 38    5,824 4,164 3,252 234 66 494 45 74 97 8,303 276 650 6,690 749 1,258 1,453 915 128 1,126 813 38 2,932 4,640 2,560 5,458 5,636 5,213
ath-miR156c-3p GCUCACUGCUCUAUCUGUCAGA 22 1,762 104 331 3    43 110 250 0 0 0 0 0 0 331 10 44 152 18 53 5 0 0 0 3 0 123 84 97 141 144 154
ath-miR156c-5p UGACAGAAGAGAGUGAGCAC 20 63,088 2,337 8,303 38    5,824 4,164 3,252 234 66 494 45 74 97 8,303 276 650 6,690 749 1,258 1,453 915 128 1,126 813 38 2,932 4,640 2,560 5,458 5,636 5,213
ath-miR156d-3p GCUCACUCUCUUUUUGUCAUAAC 23 1,521 72 656 3    13 36 45 0 0 0 0 3 9 30 0 13 6 3 18 656 17 0 199 48 22 46 37 5 95 95 125
ath-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 63,088 2,337 8,303 38    5,824 4,164 3,252 234 66 494 45 74 97 8,303 276 650 6,690 749 1,258 1,453 915 128 1,126 813 38 2,932 4,640 2,560 5,458 5,636 5,213
ath-miR156e UGACAGAAGAGAGUGAGCAC 20 63,088 2,337 8,303 38    5,824 4,164 3,252 234 66 494 45 74 97 8,303 276 650 6,690 749 1,258 1,453 915 128 1,126 813 38 2,932 4,640 2,560 5,458 5,636 5,213
ath-miR156f-3p GCUCACUCUCUAUCCGUCACC 21 4 1 1 1    1 0 1 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR156f-5p UGACAGAAGAGAGUGAGCAC 20 63,088 2,337 8,303 38    5,824 4,164 3,252 234 66 494 45 74 97 8,303 276 650 6,690 749 1,258 1,453 915 128 1,126 813 38 2,932 4,640 2,560 5,458 5,636 5,213
ath-miR156g CGACAGAAGAGAGUGAGCAC 20 209 13 51 1    24 17 7 3 0 0 0 0 0 36 0 2 51 12 13 3 0 0 0 0 0 1 21 1 7 5 6
ath-miR156h UGACAGAAGAAAGAGAGCAC 20 25 4 13 1    1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 13 0 0 2 0 0 0 0 0 3 2 3
ath-miR156i UGACAGAAGAGAGAGAGCAG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR156j UGACAGAAGAGAGAGAGCAC 20 68 5 20 2    20 3 4 3 0 0 0 0 0 9 0 0 7 0 0 3 0 0 2 2 0 2 0 3 3 0 7
ath-miR157a-3p GCUCUCUAGCCUUCUGUCAUC 21 4,831 210 1,213 3    457 427 263 116 0 0 0 3 7 1,213 113 44 409 567 86 112 69 43 16 107 0 129 145 122 139 104 140
ath-miR157a-5p UUGACAGAAGAUAGAGAGCAC 21 566,343 21,782 113,533 20    894 1,227 1,845 41 33 370 0 77 20 1,347 36 155 822 190 288 35,369 1,513 1,958 12,153 4,556 1,360 57,809 78,183 52,048 100,339 113,533 100,177
ath-miR157b-3p GCUCUCUAGCCUUCUGUCAUC 21 4,831 210 1,213 3    457 427 263 116 0 0 0 3 7 1,213 113 44 409 567 86 112 69 43 16 107 0 129 145 122 139 104 140
ath-miR157b-5p UUGACAGAAGAUAGAGAGCAC 21 566,343 21,782 113,533 20    894 1,227 1,845 41 33 370 0 77 20 1,347 36 155 822 190 288 35,369 1,513 1,958 12,153 4,556 1,360 57,809 78,183 52,048 100,339 113,533 100,177
ath-miR157c-3p GCUCUCUAUACUUCUGUCACC 21 119,518 4,427 33,089 30    5,705 33,089 6,401 57 66 165 30 74 545 21,232 901 4,846 20,020 5,993 8,003 2,324 1,673 94 1,142 986 95 737 460 373 1,512 1,253 1,742
ath-miR157c-5p UUGACAGAAGAUAGAGAGCAC 21 566,343 21,782 113,533 20    894 1,227 1,845 41 33 370 0 77 20 1,347 36 155 822 190 288 35,369 1,513 1,958 12,153 4,556 1,360 57,809 78,183 52,048 100,339 113,533 100,177
ath-miR157d UGACAGAAGAUAGAGAGCAC 20 21,427 974 3,592 2    16 37 33 8 0 0 0 0 0 15 5 2 20 35 7 685 390 26 634 1,311 25 2,472 3,295 2,160 3,204 3,455 3,592
ath-miR158a-3p UCCCAAAUGUAGACAAAGCA 20 1,387,502 51,389 285,976 39    48,255 25,894 3,180 1,291 471 1,152 39 181 190 285,976 11,255 10,879 187,403 8,596 14,553 10,889 14,844 17,161 5,574 24,854 10,750 147,305 119,669 72,322 108,895 104,527 151,397
ath-miR158a-5p CUUUGUCUACAAUUUUGGAAA 21 26,371 1,055 6,631 4    1,536 5,649 4,318 17 74 247 6 101 84 2,947 128 1,500 6,631 219 2,158 31 22 0 4 14 0 122 121 132 84 145 81
ath-miR158b CCCCAAAUGUAGACAAAGCA 20 2,912 139 1,211 4    174 97 11 10 0 0 0 0 4 1,211 51 64 805 32 138 5 13 9 0 20 0 63 49 46 29 30 51
ath-miR159a UUUGGAUUGAAGGGAGCUCUA 21 1,706,777 63,214 255,844 87    115,649 44,098 61,876 3,851 1,973 15,793 87 3,854 766 193,458 22,729 10,898 255,844 13,108 15,914 52,323 269 18,529 16,408 561 21,389 78,398 125,619 74,493 201,023 155,802 202,065
ath-miR159b-3p UUUGGAUUGAAGGGAGCUCUU 21 1,373,640 50,876 311,377 175    172,519 48,623 61,774 5,944 2,741 25,746 175 4,780 848 242,658 15,938 18,306 311,377 12,263 29,912 49,293 286 7,524 15,183 484 9,104 35,509 51,299 34,061 60,917 86,173 70,203
ath-miR159b-5p GAGCUCCUUGAAGUUCAAUGG 21 457 38 144 1    31 41 9 0 0 0 0 0 0 62 5 66 144 3 90 0 0 0 0 0 0 0 0 0 2 1 3
ath-miR159c UUUGGAUUGAAGGGAGCUCCU 21 3,782 180 1,101 10    392 112 181 17 17 123 0 17 0 1,022 133 117 1,101 76 136 36 0 0 14 0 0 13 38 10 67 95 65
ath-miR160a-3p GCGUAUGAGGAGCCAUGCAUA 21 118 15 33 1    6 19 21 0 0 0 0 0 0 33 0 0 33 0 4 0 0 0 0 0 0 1 0 0 0 1 0
ath-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 905 45 299 1    47 112 8 1 0 0 0 0 2 299 10 42 59 38 92 42 0 9 7 0 0 36 29 13 11 12 36
ath-miR160b UGCCUGGCUCCCUGUAUGCCA 21 905 45 299 1    47 112 8 1 0 0 0 0 2 299 10 42 59 38 92 42 0 9 7 0 0 36 29 13 11 12 36
ath-miR160c-3p CGUACAAGGAGUCAAGCAUGA 21 3,717 196 756 3    62 105 164 0 8 41 0 7 0 182 5 4 64 3 29 23 0 0 0 0 0 588 435 478 403 756 360
ath-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 905 45 299 1    47 112 8 1 0 0 0 0 2 299 10 42 59 38 92 42 0 9 7 0 0 36 29 13 11 12 36
ath-miR161.1 UGAAAGUGACUACAUCGGGGU 21 1,392,615 51,578 166,031 408    119,572 151,770 127,796 4,621 5,631 34,095 600 8,785 3,480 166,031 15,457 92,342 158,121 22,216 163,727 15,909 408 9,542 7,266 1,102 8,618 37,894 42,459 34,714 47,419 65,784 47,256
ath-miR161.2 UCAAUGCAUUGAAAGUGACUA 21 11,298 538 2,102 5    31 76 124 0 0 0 0 0 0 295 5 38 146 6 33 623 26 410 333 66 156 2,102 1,514 764 1,271 1,385 1,894
ath-miR162a-3p UCGAUAAACCUCUGCAUCCAG 21 1,154,626 42,764 361,172 238    102,125 145,823 44,079 910 3,245 12,009 250 4,787 1,809 345,155 9,806 41,366 361,172 9,730 62,040 1,004 238 299 580 615 245 1,702 995 742 1,158 1,046 1,696
ath-miR162a-5p UGGAGGCAGCGGUUCAUCGAUC 22 2,655 121 717 3    257 138 265 8 0 82 0 17 4 717 20 11 663 70 86 70 4 0 91 3 0 12 12 0 36 42 47
ath-miR162b-3p UCGAUAAACCUCUGCAUCCAG 21 1,154,626 42,764 361,172 238    102,125 145,823 44,079 910 3,245 12,009 250 4,787 1,809 345,155 9,806 41,366 361,172 9,730 62,040 1,004 238 299 580 615 245 1,702 995 742 1,158 1,046 1,696
ath-miR162b-5p UGGAGGCAGCGGUUCAUCGAUC 22 2,655 121 717 3    257 138 265 8 0 82 0 17 4 717 20 11 663 70 86 70 4 0 91 3 0 12 12 0 36 42 47
ath-miR163 UUGAAGAGGACUUGGAACUUCGAU 24 145,687 5,396 23,073 3    4,792 3,479 3,654 528 132 1,234 3 436 29 14,814 1,725 732 23,073 1,035 964 22,884 104 16,126 6,591 180 10,442 5,566 9,144 5,693 3,960 3,621 4,746
ath-miR164a UGGAGAAGCAGGGCACGUGCA 21 13,301 493 1,463 4    512 510 709 20 25 370 6 74 4 1,147 92 192 641 97 277 1,463 17 34 807 27 238 1,148 981 582 948 1,293 1,087
ath-miR164b-3p CAUGUGCCCAUCUUCACCAUC 21 161 12 31 1    2 10 1 0 0 0 0 0 0 31 0 2 21 0 9 0 0 0 0 0 0 11 11 15 14 10 24
ath-miR164b-5p UGGAGAAGCAGGGCACGUGCA 21 13,301 493 1,463 4    512 510 709 20 25 370 6 74 4 1,147 92 192 641 97 277 1,463 17 34 807 27 238 1,148 981 582 948 1,293 1,087
ath-miR164c-3p CACGUGUUCUACUACUCCAAC 21 5,356 282 2,143 5    239 379 147 6 0 41 0 0 29 2,143 67 186 1,658 105 165 0 0 0 0 0 29 41 5 25 43 23 25
ath-miR164c-5p UGGAGAAGCAGGGCACGUGCG 21 1,338 61 209 6    43 100 136 6 0 123 0 10 0 209 10 33 68 47 22 202 26 0 25 46 0 81 47 6 22 22 54
ath-miR165a-3p UCGGACCAGGCUUCAUCCCCC 21 408,683 15,136 72,065 9    12,349 5,178 1,151 993 471 905 9 222 24 72,065 11,577 1,851 42,383 8,604 2,268 54,504 1,613 2,668 33,851 8,698 5,240 22,476 12,937 9,681 26,609 27,123 43,233
ath-miR165a-5p GGAAUGUUGUCUGGAUCGAGG 21 15,893 611 2,306 2    1,306 450 47 402 487 41 0 258 2 1,062 952 190 835 889 303 163 100 188 340 367 168 330 460 313 2,306 1,803 2,131
ath-miR165b UCGGACCAGGCUUCAUCCCCC 21 408,683 15,136 72,065 9    12,349 5,178 1,151 993 471 905 9 222 24 72,065 11,577 1,851 42,383 8,604 2,268 54,504 1,613 2,668 33,851 8,698 5,240 22,476 12,937 9,681 26,609 27,123 43,233
ath-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 2,621,360 97,087 423,185 84    59,080 28,207 18,348 10,221 2,287 15,053 84 2,696 219 259,954 69,417 5,829 164,528 50,766 7,843 423,185 21,060 14,963 262,572 121,922 17,550 161,321 93,014 82,231 210,476 180,365 338,169
ath-miR166a-5p GGACUGUUGUCUGGCUCGAGG 21 18,985 730 3,426 4    1,544 3,108 3,031 37 25 0 15 44 53 3,426 154 507 1,063 456 641 80 4 51 75 20 57 666 733 785 780 840 790
ath-miR166b-3p UCGGACCAGGCUUCAUUCCCC 21 2,621,360 97,087 423,185 84    59,080 28,207 18,348 10,221 2,287 15,053 84 2,696 219 259,954 69,417 5,829 164,528 50,766 7,843 423,185 21,060 14,963 262,572 121,922 17,550 161,321 93,014 82,231 210,476 180,365 338,169
ath-miR166b-5p GGACUGUUGUCUGGCUCGAGG 21 18,985 730 3,426 4    1,544 3,108 3,031 37 25 0 15 44 53 3,426 154 507 1,063 456 641 80 4 51 75 20 57 666 733 785 780 840 790
ath-miR166c UCGGACCAGGCUUCAUUCCCC 21 2,621,360 97,087 423,185 84    59,080 28,207 18,348 10,221 2,287 15,053 84 2,696 219 259,954 69,417 5,829 164,528 50,766 7,843 423,185 21,060 14,963 262,572 121,922 17,550 161,321 93,014 82,231 210,476 180,365 338,169
ath-miR166d UCGGACCAGGCUUCAUUCCCC 21 2,621,360 97,087 423,185 84    59,080 28,207 18,348 10,221 2,287 15,053 84 2,696 219 259,954 69,417 5,829 164,528 50,766 7,843 423,185 21,060 14,963 262,572 121,922 17,550 161,321 93,014 82,231 210,476 180,365 338,169
ath-miR166e-3p UCGGACCAGGCUUCAUUCCCC 21 2,621,360 97,087 423,185 84    59,080 28,207 18,348 10,221 2,287 15,053 84 2,696 219 259,954 69,417 5,829 164,528 50,766 7,843 423,185 21,060 14,963 262,572 121,922 17,550 161,321 93,014 82,231 210,476 180,365 338,169
ath-miR166e-5p GGAAUGUUGUCUGGCACGAGG 21 13,976 608 2,033 7    901 836 1,284 7 8 0 0 0 18 1,234 20 148 988 94 296 119 26 9 55 32 0 1,592 1,367 2,033 930 1,078 901
ath-miR166f UCGGACCAGGCUUCAUUCCCC 21 2,621,360 97,087 423,185 84    59,080 28,207 18,348 10,221 2,287 15,053 84 2,696 219 259,954 69,417 5,829 164,528 50,766 7,843 423,185 21,060 14,963 262,572 121,922 17,550 161,321 93,014 82,231 210,476 180,365 338,169
ath-miR166g UCGGACCAGGCUUCAUUCCCC 21 2,621,360 97,087 423,185 84    59,080 28,207 18,348 10,221 2,287 15,053 84 2,696 219 259,954 69,417 5,829 164,528 50,766 7,843 423,185 21,060 14,963 262,572 121,922 17,550 161,321 93,014 82,231 210,476 180,365 338,169
ath-miR167a-3p GAUCAUGUUCGCAGUUUCACC 21 110,161 4,590 28,565 3    18 71 186 0 8 0 3 7 0 105 10 9 80 38 24 1,336 629 9 462 343 3 10,522 13,326 10,787 28,565 18,624 24,996
ath-miR167a-5p UGAAGCUGCCAGCAUGAUCUA 21 153,393 5,681 21,424 6    1,395 4,728 15,930 96 339 2,056 6 940 40 10,774 553 1,234 4,802 1,404 1,960 13,382 234 1,744 4,022 282 1,204 21,311 11,129 6,799 11,740 13,865 21,424
ath-miR167b UGAAGCUGCCAGCAUGAUCUA 21 153,393 5,681 21,424 6    1,395 4,728 15,930 96 339 2,056 6 940 40 10,774 553 1,234 4,802 1,404 1,960 13,382 234 1,744 4,022 282 1,204 21,311 11,129 6,799 11,740 13,865 21,424
ath-miR167c-3p UAGGUCAUGCUGGUAGUUUCACC 23 3,602 172 839 3    70 292 839 3 8 82 9 13 20 303 164 117 723 284 112 0 0 0 0 0 0 92 115 72 90 82 112
ath-miR167c-5p UAAGCUGCCAGCAUGAUCUUG 21 60 7 18 2    0 5 18 0 0 0 0 0 0 2 0 0 3 3 0 0 0 0 0 0 0 4 12 0 4 0 9
ath-miR167d UGAAGCUGCCAGCAUGAUCUGG 22 31,605 1,216 4,856 13    156 826 1,621 17 58 329 0 114 26 332 41 64 136 70 72 4,062 82 60 2,977 189 13 3,431 3,332 1,572 2,767 4,402 4,856
ath-miR168a-3p CCCGCCUUGCAUCAACUGAAU 21 56,591 2,264 21,730 4    4,313 4,844 1,856 13 25 206 9 40 38 21,730 133 582 20,488 76 922 182 4 0 21 0 32 320 129 80 107 111 330
ath-miR168a-5p UCGCUUGGUGCAGGUCGGGAA 21 184,056 7,079 33,073 29    3,746 3,068 4,929 76 149 494 0 322 29 16,935 594 493 9,693 459 634 21,011 958 368 8,259 721 191 33,073 16,733 18,086 11,028 14,273 17,734
ath-miR168b-3p CCCGUCUUGUAUCAACUGAAU 21 25,804 1,032 6,904 5    2,190 3,843 1,756 20 0 82 15 40 53 6,445 292 925 6,904 529 1,196 573 17 0 84 5 38 250 148 104 93 76 126
ath-miR168b-5p UCGCUUGGUGCAGGUCGGGAA 21 184,056 7,079 33,073 29    3,746 3,068 4,929 76 149 494 0 322 29 16,935 594 493 9,693 459 634 21,011 958 368 8,259 721 191 33,073 16,733 18,086 11,028 14,273 17,734
ath-miR169a-3p GGCAAGUUGUCCUUGGCUAC 20 1,031 94 262 2    0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 21 30 0 2 27 0 93 79 43 224 262 248
ath-miR169a-5p CAGCCAAGGAUGACUUGCCGA 21 884 74 165 2    0 0 0 0 0 0 0 0 0 3 0 0 5 0 2 122 0 0 68 14 0 68 116 72 141 108 165
ath-miR169b-3p GGCAAGUUGUCCUUCGGCUACA 22 25 4 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 1 5 0 7 3 6
ath-miR169b-5p CAGCCAAGGAUGACUUGCCGG 21 29 5 9 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 8 4 0 0 3 0 0 9 0 0 4 1
ath-miR169c CAGCCAAGGAUGACUUGCCGG 21 29 5 9 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 8 4 0 0 3 0 0 9 0 0 4 1
ath-miR169d UGAGCCAAGGAUGACUUGCCG 21 3 2 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 1 0 0 0 0 0
ath-miR169e UGAGCCAAGGAUGACUUGCCG 21 3 2 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 1 0 0 0 0 0
ath-miR169f-3p GCAAGUUGACCUUGGCUCUGC 21 5,911 296 1,881 1    559 279 90 1 0 0 0 7 5 1,425 15 243 1,881 32 393 5 0 0 25 0 0 171 219 240 83 143 95
ath-miR169f-5p UGAGCCAAGGAUGACUUGCCG 21 3 2 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 1 0 0 0 0 0
ath-miR169g-3p UCCGGCAAGUUGACCUUGGCU 21 3 2 2 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0
ath-miR169g-5p UGAGCCAAGGAUGACUUGCCG 21 3 2 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 1 0 0 0 0 0
ath-miR169h UAGCCAAGGAUGACUUGCCUG 21 5,725 409 1,194 3    0 0 3 0 0 0 0 0 0 3 0 0 4 0 0 789 61 26 206 49 0 352 829 175 1,194 901 1,133
ath-miR169i UAGCCAAGGAUGACUUGCCUG 21 5,725 409 1,194 3    0 0 3 0 0 0 0 0 0 3 0 0 4 0 0 789 61 26 206 49 0 352 829 175 1,194 901 1,133
ath-miR169j UAGCCAAGGAUGACUUGCCUG 21 5,725 409 1,194 3    0 0 3 0 0 0 0 0 0 3 0 0 4 0 0 789 61 26 206 49 0 352 829 175 1,194 901 1,133
ath-miR169k UAGCCAAGGAUGACUUGCCUG 21 5,725 409 1,194 3    0 0 3 0 0 0 0 0 0 3 0 0 4 0 0 789 61 26 206 49 0 352 829 175 1,194 901 1,133
ath-miR169l UAGCCAAGGAUGACUUGCCUG 21 5,725 409 1,194 3    0 0 3 0 0 0 0 0 0 3 0 0 4 0 0 789 61 26 206 49 0 352 829 175 1,194 901 1,133
ath-miR169m UAGCCAAGGAUGACUUGCCUG 21 5,725 409 1,194 3    0 0 3 0 0 0 0 0 0 3 0 0 4 0 0 789 61 26 206 49 0 352 829 175 1,194 901 1,133
ath-miR169n UAGCCAAGGAUGACUUGCCUG 21 5,725 409 1,194 3    0 0 3 0 0 0 0 0 0 3 0 0 4 0 0 789 61 26 206 49 0 352 829 175 1,194 901 1,133
ath-miR170-3p UGAUUGAGCCGUGUCAAUAUC 21 8,563 612 1,976 1    1 0 5 0 0 0 0 0 0 3 0 0 6 0 0 36 0 17 9 3 0 1,176 1,976 1,403 1,164 1,804 960
ath-miR170-5p UAUUGGCCUGGUUCACUCAGA 21 6,350 265 2,668 2    222 85 179 4 8 0 0 0 2 2,310 97 64 2,668 97 66 21 4 9 34 27 29 95 38 19 79 72 121
ath-miR171a-3p UGAUUGAGCCGCGCCAAUAUC 21 5,448 218 1,206 2    14 22 22 7 0 82 0 7 2 95 41 4 55 50 13 86 9 51 43 10 48 623 902 653 778 1,206 625
ath-miR171a-5p UAUUGGCCUGGUUCACUCAGA 21 6,350 265 2,668 2    222 85 179 4 8 0 0 0 2 2,310 97 64 2,668 97 66 21 4 9 34 27 29 95 38 19 79 72 121
ath-miR171b-3p UUGAGCCGUGCCAAUAUCACG 21 2,191 91 530 1    64 333 530 1 0 41 0 13 2 410 5 29 133 12 48 36 4 0 21 5 38 93 38 31 86 107 111
ath-miR171b-5p AGAUAUUAGUGCGGUUCAAUC 21 6,526 311 2,051 1    35 99 104 1 0 0 0 3 0 160 15 35 44 26 53 49 13 0 61 0 54 322 315 251 2,051 1,115 1,720
ath-miR171c-3p UUGAGCCGUGCCAAUAUCACG 21 2,191 91 530 1    64 333 530 1 0 41 0 13 2 410 5 29 133 12 48 36 4 0 21 5 38 93 38 31 86 107 111
ath-miR171c-5p AGAUAUUGGUGCGGUUCAAUC 21 2,130 107 514 3    9 32 22 0 0 0 0 0 0 34 5 9 17 3 9 109 0 9 9 20 54 154 141 145 420 514 415
ath-miR172a AGAAUCUUGAUGAUGCUGCAU 21 4,989 227 645 9    38 165 147 0 0 0 0 10 0 364 15 210 433 18 233 589 43 9 229 73 146 277 579 219 279 645 268
ath-miR172b-3p AGAAUCUUGAUGAUGCUGCAU 21 4,989 227 645 9    38 165 147 0 0 0 0 10 0 364 15 210 433 18 233 589 43 9 229 73 146 277 579 219 279 645 268
ath-miR172b-5p GCAGCACCAUUAAGAUUCAC 20 1,150 64 223 8    86 223 83 11 0 0 0 0 0 164 31 24 44 173 29 8 100 0 20 110 0 12 0 12 12 0 8
ath-miR172c AGAAUCUUGAUGAUGCUGCAG 21 58 7 17 1    1 17 1 0 0 0 0 0 0 17 5 4 9 0 4 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR172d-3p AGAAUCUUGAUGAUGCUGCAG 21 58 7 17 1    1 17 1 0 0 0 0 0 0 17 5 4 9 0 4 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR172d-5p GCAACAUCUUCAAGAUUCAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR172e-3p GGAAUCUUGAUGAUGCUGCAU 21 73 7 17 1    1 5 1 0 0 0 0 0 0 2 0 0 1 0 7 13 0 0 0 0 0 0 17 0 8 4 14
ath-miR172e-5p GCAGCACCAUUAAGAUUCAC 20 1,150 64 223 8    86 223 83 11 0 0 0 0 0 164 31 24 44 173 29 8 100 0 20 110 0 12 0 12 12 0 8
ath-miR173-3p UGAUUCUCUGUGUAAGCGAAA 21 12 2 3 1    1 0 1 0 0 0 0 0 0 2 0 2 3 0 0 0 0 0 0 0 0 0 0 0 0 3 0
ath-miR173-5p UUCGCUUGCAGAGAGAAAUCAC 22 3,997 190 599 5    47 104 169 0 0 0 0 13 5 270 5 46 169 18 101 291 17 0 170 34 0 401 526 348 324 599 340
ath-miR1886.1 UGAGAGAAGUGAGAUGAAAUC 21 270 18 50 3    5 15 10 0 0 0 3 0 0 7 5 0 5 0 4 26 0 0 0 0 0 35 50 27 26 36 16
ath-miR1886.2 UGAGAUGAAAUCUUUGAUUGG 21 950 56 182 7    21 10 39 0 0 0 0 0 0 17 0 7 19 0 9 80 17 0 21 20 0 66 182 61 106 150 125
ath-miR1886.3 AAUUAAAGAUUUCAUCUUACU 21 9 2 4 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 4 1
ath-miR1887 UACUAAGUAGAGUCUAAGAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR1888a UAAGUUAAGAUUUGUGAAGAA 21 998 59 185 3    34 7 46 0 0 0 0 0 0 117 5 7 97 3 4 13 0 0 0 0 54 45 103 40 185 76 162
ath-miR1888b UUAGGCUAAGAUUUGUGAAGA 21 17 3 7 1    3 2 1 0 0 0 0 0 0 7 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR2111a-3p GUCCUCGGGAUGCGGAUUACC 21 5 5 5 5    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0
ath-miR2111a-5p UAAUCUGCAUCCUGAGGUUUA 21 1 1 1 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR2111b-3p AUCCUCGGGAUACAGUUUACC 21 50 5 15 1    0 5 0 0 0 0 0 0 0 4 0 15 1 3 7 0 0 0 0 0 0 0 3 0 2 1 9
ath-miR2111b-5p UAAUCUGCAUCCUGAGGUUUA 21 1 1 1 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR2112-3p CUUUAUAUCCGCAUUUGCGCA 21 70 12 20 2    2 0 0 0 0 0 0 0 0 20 0 0 16 0 15 0 0 0 0 0 0 7 0 10 0 0 0
ath-miR2112-5p CGCAAAUGCGGAUAUCAAUGU 21 114 11 42 2    2 3 0 0 0 0 0 0 0 17 0 9 6 0 2 0 0 0 0 0 0 26 4 42 0 0 3
ath-miR2933a GAAAUCGGAGAGGAAAUUCGCC 22 32 8 17 2    0 0 0 3 17 0 0 10 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0
ath-miR2933b GAAAUCGGAGAGGAAAUUCGCC 22 32 8 17 2    0 0 0 3 17 0 0 10 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0
ath-miR2934-3p CAUCCAAGGUGUUUGUAGAAA 21 2 1 1 1    1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR2934-5p UCUUUCUGCAAACGCCUUGGA 21 11 2 4 1    1 0 0 0 0 0 0 0 0 1 0 0 0 3 0 0 0 0 0 0 0 0 1 0 1 0 4
ath-miR2936 CUUGAGAGAGAGAACACAGACG 22 1,711 107 718 1    2 3 0 718 116 0 0 208 0 1 241 18 6 360 15 0 0 0 0 5 0 4 5 6 0 3 0
ath-miR2937 AUAAGAGCUGUUGAAGGAGUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR2938 GAUCUUUUGAGAGGGUUCCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR2939 UAACGCACAACACUAAGCCAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR319a UUGGACUGAAGGGAGCUCCCU 21 12,236 532 2,552 2    724 39 5 30 0 0 0 0 2 1,175 348 128 2,552 278 209 363 13 68 297 34 102 729 933 347 980 1,117 1,763
ath-miR319b UUGGACUGAAGGGAGCUCCCU 21 12,236 532 2,552 2    724 39 5 30 0 0 0 0 2 1,175 348 128 2,552 278 209 363 13 68 297 34 102 729 933 347 980 1,117 1,763
ath-miR319c UUGGACUGAAGGGAGCUCCUU 21 1,535 73 450 4    58 44 53 10 0 41 0 0 4 350 77 13 450 56 55 67 0 60 38 0 0 11 32 16 23 37 40
ath-miR3434-3p UCAGAGUAUCAGCCAUGUGA 20 9 2 4 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 3 4 0 0 1 0
ath-miR3434-5p ACUUGGCUGAUUCUAUUAUU 20 644 43 204 3    72 42 4 0 0 0 0 0 0 183 10 29 204 15 46 0 0 0 0 0 0 8 3 7 7 10 4
ath-miR3440b-3p UGGAUUGGUCAAGGGAAGCGU 21 244 16 63 1    32 5 1 1 0 0 0 0 0 63 5 9 59 6 29 0 0 0 0 0 0 7 0 13 2 10 2
ath-miR3440b-5p UUUUCUUGGCCCAUCCACUUC 21 24 4 7 1    0 2 0 0 0 0 0 0 0 7 0 0 4 0 0 0 0 0 0 5 0 0 0 0 1 0 5
ath-miR390a-3p CGCUAUCCAUCCUGAGUUUCA 21 19,552 931 4,097 3    1,482 4,097 1,286 3 17 82 0 10 57 3,621 82 1,829 3,904 164 2,816 16 0 0 0 0 0 18 16 5 18 7 22
ath-miR390a-5p AAGCUCAGGAGGGAUAGCGCC 21 48,997 1,885 8,015 1    228 955 1,876 1 17 0 3 37 9 3,341 123 422 2,341 205 792 1,842 91 43 823 190 213 6,205 4,790 3,489 6,425 6,521 8,015
ath-miR390b-3p CGCUAUCCAUCCUGAGUUCC 20 7,350 459 2,160 3    228 124 9 0 0 0 3 0 4 2,160 72 807 1,986 304 1,613 0 0 0 0 0 0 3 8 0 5 19 5
ath-miR390b-5p AAGCUCAGGAGGGAUAGCGCC 21 48,997 1,885 8,015 1    228 955 1,876 1 17 0 3 37 9 3,341 123 422 2,341 205 792 1,842 91 43 823 190 213 6,205 4,790 3,489 6,425 6,521 8,015
ath-miR391-3p ACGGUAUCUCUCCUACGUAGC 21 26,139 1,005 3,394 4    97 695 697 20 33 82 0 57 4 1,782 169 177 442 412 202 1,338 360 282 367 1,205 184 3,246 2,996 3,201 3,394 1,441 3,256
ath-miR391-5p UUCGCAGGAGAGAUAGCGCCA 21 9,401 409 1,613 1    109 369 392 1 0 123 0 30 0 759 10 51 308 32 42 441 9 9 129 10 0 889 1,454 911 923 1,613 787
ath-miR3932a AACUUUGUGAUGACAACGAAG 21 4 2 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 3 0
ath-miR3932b-3p AACUUUGUGAUGACAACGAAG 21 4 2 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 3 0
ath-miR3932b-5p UUUGACGUGCUCGAUCUGCUC 21 154,184 6,167 61,516 3    20,781 6,895 4,938 405 132 1,069 24 410 106 40,447 1,684 4,650 61,516 1,723 7,167 52 0 17 30 3 0 353 290 224 435 404 429
ath-miR3933 AGAAGCAAAAUGACGACUCGG 21 423 28 107 1    1 5 6 0 0 0 0 7 0 5 0 0 5 3 0 8 0 34 0 0 0 90 107 103 14 13 22
ath-miR393a-3p AUCAUGCUAUCUCUUUGGAUU 21 7,895 292 1,125 9    58 636 1,125 41 157 699 9 222 29 907 97 46 41 175 37 433 26 34 124 31 54 650 584 376 349 501 454
ath-miR393a-5p UCCAAAGGGAUCGCAUUGAUCC 22 2,486 124 427 1    20 5 1 1 0 0 0 0 0 38 5 38 55 23 53 205 30 0 61 2 0 246 427 173 334 365 404
ath-miR393b-3p AUCAUGCGAUCUCUUUGGAUU 21 251,015 9,297 57,409 78    6,913 37,906 49,039 342 1,808 13,408 78 4,143 938 57,409 3,163 5,043 17,199 5,159 6,980 13,426 156 1,479 5,447 214 1,411 5,113 2,346 1,234 2,530 2,599 5,532
ath-miR393b-5p UCCAAAGGGAUCGCAUUGAUCC 22 2,486 124 427 1    20 5 1 1 0 0 0 0 0 38 5 38 55 23 53 205 30 0 61 2 0 246 427 173 334 365 404
ath-miR394a UUGGCAUUCUGUCCACCUCC 20 1,964 103 284 2    126 8 2 3 0 0 0 0 0 284 41 60 240 41 158 0 4 34 0 0 181 129 166 70 116 147 154
ath-miR394b-3p AGGUGGGCAUACUGCCAAUAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR394b-5p UUGGCAUUCUGUCCACCUCC 20 1,964 103 284 2    126 8 2 3 0 0 0 0 0 284 41 60 240 41 158 0 4 34 0 0 181 129 166 70 116 147 154
ath-miR395a CUGAAGUGUUUGGGGGAACUC 21 4,932 183 500 3    241 500 260 24 41 452 12 57 11 450 10 24 260 18 33 218 4 120 25 3 108 264 334 293 418 335 417
ath-miR395b CUGAAGUGUUUGGGGGGACUC 21 9,384 375 1,699 3    402 513 277 25 0 123 0 3 5 1,699 31 24 563 12 11 179 4 120 54 12 67 710 715 870 1,100 856 1,009
ath-miR395c CUGAAGUGUUUGGGGGGACUC 21 9,384 375 1,699 3    402 513 277 25 0 123 0 3 5 1,699 31 24 563 12 11 179 4 120 54 12 67 710 715 870 1,100 856 1,009
ath-miR395d CUGAAGUGUUUGGGGGAACUC 21 4,932 183 500 3    241 500 260 24 41 452 12 57 11 450 10 24 260 18 33 218 4 120 25 3 108 264 334 293 418 335 417
ath-miR395e CUGAAGUGUUUGGGGGAACUC 21 4,932 183 500 3    241 500 260 24 41 452 12 57 11 450 10 24 260 18 33 218 4 120 25 3 108 264 334 293 418 335 417
ath-miR395f CUGAAGUGUUUGGGGGGACUC 21 9,384 375 1,699 3    402 513 277 25 0 123 0 3 5 1,699 31 24 563 12 11 179 4 120 54 12 67 710 715 870 1,100 856 1,009
ath-miR396a-3p GUUCAAUAAAGCUGUGGGAAG 21 186,714 6,915 23,129 15    19,024 13,050 11,784 116 58 576 15 87 69 10,634 486 772 7,479 968 1,157 2,975 425 778 2,542 787 423 16,968 23,129 19,895 16,759 21,327 14,431
ath-miR396a-5p UUCCACAGCUUUCUUGAACUG 21 569,499 21,904 109,561 35    699 5,476 4,130 54 140 1,398 0 305 35 10,335 461 754 2,459 1,173 834 12,672 4,678 1,744 5,372 10,372 1,411 73,207 109,561 90,790 63,719 94,230 73,490
ath-miR396b-3p GCUCAAGAAAGCUGUGGGAAA 21 21,862 874 5,298 12    2,053 2,264 2,686 21 91 370 0 124 18 3,418 271 383 5,298 494 571 125 0 111 129 12 99 322 450 294 824 637 797
ath-miR396b-5p UUCCACAGCUUUCUUGAACUU 21 477,337 17,679 182,198 24    19,653 45,715 28,213 969 2,064 21,551 24 2,974 540 182,198 9,658 8,204 113,949 10,426 11,704 4,169 234 445 2,501 925 1,195 1,487 1,590 823 1,604 1,804 2,718
ath-miR397a UCAUUGAGUGCAGCGUUGAUG 21 102 13 25 3    0 0 0 0 0 0 0 0 0 3 0 0 3 0 0 0 0 0 0 0 0 18 25 6 20 7 20
ath-miR397b UCAUUGAGUGCAUCGUUGAUG 21 128 11 58 1    1 8 12 0 0 0 0 0 0 4 0 0 1 0 2 8 0 0 0 0 0 58 7 8 8 0 11
ath-miR398a-3p UGUGUUCUCAGGUCACCCCUU 21 4,539 267 926 1    342 483 497 21 33 41 0 23 29 926 133 783 293 292 634 0 0 0 0 0 0 1 7 0 0 0 1
ath-miR398a-5p AAGGAGUGGCAUGUGAACACA 21 2,606 124 565 3    22 19 40 3 0 0 0 10 0 266 15 7 105 9 11 565 22 0 186 17 0 272 483 247 76 125 106
ath-miR398b-3p UGUGUUCUCAGGUCACCCCUG 21 146,980 5,444 42,532 22    15,433 24,921 42,532 522 1,214 3,578 121 1,470 1,625 20,718 2,006 5,632 7,039 6,364 8,796 428 56 94 260 253 22 998 161 179 396 457 1,705
ath-miR398b-5p AGGGUUGAUAUGAGAACACAC 21 4,043 162 725 2    146 180 496 13 17 123 0 17 2 725 102 24 650 126 48 52 13 0 13 53 51 256 145 103 198 221 269
ath-miR398c-3p UGUGUUCUCAGGUCACCCCUG 21 146,980 5,444 42,532 22    15,433 24,921 42,532 522 1,214 3,578 121 1,470 1,625 20,718 2,006 5,632 7,039 6,364 8,796 428 56 94 260 253 22 998 161 179 396 457 1,705
ath-miR398c-5p AGGGUUGAUAUGAGAACACAC 21 4,043 162 725 2    146 180 496 13 17 123 0 17 2 725 102 24 650 126 48 52 13 0 13 53 51 256 145 103 198 221 269
ath-miR399a UGCCAAAGGAGAUUUGCCCUG 21 61 5 12 1    1 2 1 0 0 0 0 0 0 9 0 0 1 0 4 0 0 0 0 0 0 12 9 5 1 6 10
ath-miR399b UGCCAAAGGAGAGUUGCCCUG 21 5,990 240 1,818 1    186 138 1,380 1 0 41 0 7 2 1,818 51 73 1,125 29 123 130 4 26 66 8 29 124 113 57 127 82 250
ath-miR399c-3p UGCCAAAGGAGAGUUGCCCUG 21 5,990 240 1,818 1    186 138 1,380 1 0 41 0 7 2 1,818 51 73 1,125 29 123 130 4 26 66 8 29 124 113 57 127 82 250
ath-miR399c-5p GGGCAUCUUUCUAUUGGCAGG 21 55 6 18 1    0 3 18 0 0 0 0 0 0 1 0 0 2 0 0 0 0 0 0 0 0 2 7 0 7 6 9
ath-miR399d UGCCAAAGGAGAUUUGCCCCG 21 1 1 1 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR399e UGCCAAAGGAGAUUUGCCUCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR399f UGCCAAAGGAGAUUUGCCCGG 21 10 3 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 7 0 0 0 1
ath-miR400 UAUGAGAGUAUUAUAAGUCAC 21 3,158 166 645 1    1 3 13 0 0 41 0 0 0 14 0 0 2 9 4 272 22 128 120 27 0 392 319 280 446 645 420
ath-miR401 CGAAACUGGUGUCGACCGACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR402 UUCGAGGCCUAUUAAACCUCUG 22 26 4 16 1    1 2 1 0 0 0 0 0 0 4 0 0 16 0 0 0 0 0 0 0 0 2 0 0 0 0 0
ath-miR403-3p UUAGAUUCACGCACAAACUCG 21 108,486 4,173 24,145 66    2,922 5,879 4,798 112 272 1,604 0 369 66 24,145 1,494 947 9,926 1,351 1,409 6,978 1,916 633 3,133 3,388 693 7,895 6,029 3,361 5,676 4,954 8,536
ath-miR403-5p UGUUUUGUGCUUGAAUCUAAUU 22 4,323 160 1,077 6    396 486 1,077 7 25 41 6 54 16 546 82 150 180 126 336 270 13 26 72 24 38 59 65 48 60 62 58
ath-miR404 AUUAACGCUGGCGGUUGCGGCAGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR405a AUGAGUUGGGUCUAACCCAUAACU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR405b AUGAGUUGGGUCUAACCCAUAACU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR405d AUGAGUUGGGUCUAACCCAUAACU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR406 UAGAAUGCUAUUGUAAUCCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR407 UUUAAAUCAUAUACUUUUGGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR408-3p AUGCACUGCCUCUUCCCUGGC 21 68,606 2,541 16,124 21    6,154 15,863 8,191 238 520 2,139 51 648 378 16,124 676 2,612 7,132 1,802 3,841 306 26 257 79 49 655 258 55 21 140 83 308
ath-miR408-5p ACAGGGAACAAGCAGAGCAUG 21 29,253 1,219 10,049 4    2,227 1,793 2,623 86 107 206 0 97 18 8,615 558 283 10,049 363 485 503 4 0 132 10 0 261 92 172 168 181 220
ath-miR413 AUAGUUUCUCUUGUUCUGCAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR414 UCAUCUUCAUCAUCAUCGUCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR415 AACAGAGCAGAAACAGAACAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR416 GGUUCGUACGUACACUGUUCA 21 8 8 8 8    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 8 0 0 0 0 0 0 0
ath-miR417 GAAGGUAGUGAAUUUGUUCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR418 UAAUGUGAUGAUGAACUGACC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR419 UUAUGAAUGCUGAGGAUGUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR420 UAAACUAAUCACGGAAAUGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR4221 UUUUCCUCUGUUGAAUUCUUGC 22 31 5 12 3    4 3 0 0 0 0 0 0 0 12 0 0 6 0 0 0 0 0 0 0 0 0 0 0 3 0 3
ath-miR4227 UCACUGGUACCAAUCAUUCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR4228-3p UCGGAUGCGAAACGGUGGUGU 21 446 28 93 3    9 3 7 0 8 41 0 0 0 11 5 4 15 9 0 0 0 0 0 0 0 82 66 93 16 52 25
ath-miR4228-5p AUAGCCUUGAACGCCGUCGUU 21 3 2 2 1    1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR4239 UUUGUUAUUUUCGCAUGCUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR4240 UGACUAGACCCGUAACAUUAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR4243 UUGAAAUUGUAGAUUUCGUAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR4245 ACAAAGUUUUAUACUGACAAU 21 29 4 7 1    0 2 1 0 0 0 0 0 0 4 0 0 6 0 7 5 4 0 0 0 0 0 0 0 0 0 0
ath-miR426 UUUUGGAAAUUUGUCCUUACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR447a-3p UUGGGGACGAGAUGUUUUGUUG 22 4,131 188 1,646 3    428 156 198 6 0 41 3 3 4 1,105 36 80 1,646 23 125 127 0 0 30 0 0 17 26 6 12 44 15
ath-miR447a.2-3p UAUGGAAGAAAUUGUAGUAUU 21 6,037 262 1,896 2    505 165 421 3 0 0 0 37 2 1,455 133 69 1,896 44 136 65 13 0 25 3 22 165 212 103 144 211 208
ath-miR447b UUGGGGACGAGAUGUUUUGUUG 22 4,131 188 1,646 3    428 156 198 6 0 41 3 3 4 1,105 36 80 1,646 23 125 127 0 0 30 0 0 17 26 6 12 44 15
ath-miR447c-3p UUGGGGACGACAUCUUUUGUUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR447c-5p CCCCUUACAAUGUCGAGUAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR472-3p UUUUUCCUACUCCGCCCAUACC 22 3,205 123 658 1    62 168 244 1 41 41 3 30 0 658 61 58 351 73 59 189 4 51 72 10 44 137 65 55 280 165 283
ath-miR472-5p AUGGUCGAAGUAGGCAAAAUC 21 2,373 108 761 7    99 90 128 8 0 0 0 13 0 602 41 13 761 38 44 67 35 17 7 58 0 91 94 37 37 48 45
ath-miR5012 UUUUACUGCUACUUGUGUUCC 21 563 28 142 1    13 20 21 1 0 0 0 3 0 142 0 2 75 20 29 29 9 0 9 7 0 42 21 48 28 19 25
ath-miR5013 UUUGUGACAUCUAGGUGCUUU 21 18 4 6 1    0 2 0 0 0 0 6 0 0 1 0 0 5 0 4 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5014a-3p UUGUACAAAUUUAAGUGUACG 21 2 1 1 1    0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5014a-5p ACACUUAGUUUUGUACAACAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5014b AUUUGUACACCUAGAUCUGUA 21 43 6 23 1    2 12 23 0 0 0 0 0 0 2 0 0 1 0 0 0 0 0 0 0 0 2 0 0 0 0 1
ath-miR5015 UUGGUGUUAUGUGUAGUCUUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5016 UUCUUGUGGAUUCCUUGGAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5017-3p UUAUACCAAAUUAAUAGCAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5017-5p AUUUGUUACUAAUUUGGAAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5018 UUAAAGCUCCACCAUGAGUCCAAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5019 UGUUGGGAAAGAAAAACUCUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5020a UGGAAGAAGGUGAGACUUGCA 21 17 3 7 1    0 3 2 0 0 0 0 0 0 3 0 0 1 0 7 0 0 0 0 0 0 0 0 0 0 0 1
ath-miR5020b AUGGCAUGAAAGAAGGUGAGA 21 366 22 161 1    3 14 1 7 0 0 0 0 0 161 20 4 59 12 0 3 0 0 0 5 0 4 3 8 17 23 22
ath-miR5020c UGGCAUGGAAGAAGGUGAGAC 21 103 10 30 1    1 0 0 0 0 0 0 0 0 2 0 0 4 0 0 0 0 0 0 8 0 13 4 27 6 30 8
ath-miR5021 UGAGAAGAAGAAGAAGAAAA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5022 GUCAUGGGGUAUGAUCGAAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5023 AUUGGUAGUGGAUAAGGGGGC 21 123 10 41 1    1 0 0 1 0 0 0 0 0 3 5 0 4 0 0 21 0 0 0 0 0 12 15 41 6 7 7
ath-miR5024-3p CCGUAUCUUGGCCUUGUCAUU 21 666 39 177 2    23 70 20 0 8 0 0 0 2 177 10 73 89 0 103 16 0 0 0 0 0 24 9 19 8 5 10
ath-miR5024-5p AUGACAAGGCCAAGAUAUAACA 22 3 1 1 1    0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0
ath-miR5025 ACUGUAUAUAUGUAAGUGACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5026 ACUCAUAAGAUCGUGACACGU 21 465,246 17,231 189,280 26    26,817 24,974 16,574 1,680 793 4,072 33 1,524 409 189,280 7,534 17,665 125,549 10,748 25,753 288 108 26 61 104 38 2,005 1,936 1,554 1,897 1,930 1,894
ath-miR5027 ACCGGUUGGAACUUGCCUUAA 21 19 3 6 1    1 0 2 0 0 0 0 0 0 2 0 0 3 0 0 0 0 0 0 0 0 5 0 0 0 6 0
ath-miR5028 AAUUGGGUUUAUGCUAGAGUU 21 34 4 10 1    1 2 8 0 0 0 0 0 0 10 0 0 1 9 2 0 0 0 0 0 0 0 0 0 0 1 0
ath-miR5029 AAUGAGAGAGAACACUGCAAA 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5595a ACAUAUGAUCUGCAUCUUUGC 21 859 57 175 1    38 88 37 1 17 0 0 3 0 155 15 137 175 47 114 0 0 17 0 0 0 0 0 0 8 0 7
ath-miR5628 GAAAUAGCGAAGAUAUGAUUA 21 1 1 1 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5629 UUAGGGUAGUUAACGGAAGUUA 22 28 5 13 1    1 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 8 2 13
ath-miR5630a GCUAAGAGCGGUUCUGAUGGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5630b GCUAAGAGCGGUUCUGAUGGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5631 UGGCAGGAAAGACAUAAUUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5632-3p UUGGAUUUAUAGUUGGAUAAG 21 5 2 2 1    1 0 2 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5632-5p UUGAUUCUCUUAUCCAACUGU 21 38 4 10 1    1 3 2 0 0 0 0 0 0 10 0 4 5 0 0 0 0 0 0 0 0 0 5 0 1 5 2
ath-miR5633 UAUGAUCAUCAGAAAACAGUG 21 39 6 13 1    0 0 3 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 10 0 13 7 0 4
ath-miR5634 AGGGACUUUGUGAAUUUAGGG 21 583 32 82 2    26 27 66 7 0 0 0 7 0 82 20 0 43 15 0 36 0 0 7 2 0 17 22 13 57 71 65
ath-miR5635a UGUUAAGGAGUGUUAACGGUG 21 30 4 7 1    1 3 4 0 0 0 0 7 0 1 5 0 3 6 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5635b UGUUAAGGAGUGUUAACGGUG 21 30 4 7 1    1 3 4 0 0 0 0 7 0 1 5 0 3 6 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5635c UGUUAAGGAGUGUUAACGGUG 21 30 4 7 1    1 3 4 0 0 0 0 7 0 1 5 0 3 6 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5635d UGUUAAGGAGUGUUAACGGUG 21 30 4 7 1    1 3 4 0 0 0 0 7 0 1 5 0 3 6 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5636 CGUAGUUGCAGAGCUUGACGG 21 1 1 1 1    1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5637 AAUGCGCAACUCUAUAUUUCC 21 272 39 121 2    11 17 5 0 0 0 0 0 0 121 0 2 109 0 7 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5638a AUACCAAAACUCUCUCACUUU 21 5 5 5 5    0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5638b ACAGUGGUCAUCUGGUGGGCU 21 42 7 23 1    1 0 3 0 0 0 0 3 0 0 0 0 0 0 0 23 0 0 11 0 0 0 0 0 0 0 1
ath-miR5639-3p UUUAGCCUCAGACCACGGUGGACU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5639-5p UAGUCCACUGUGGUCUAAGGC 21 12 3 4 1    0 0 0 0 0 0 0 0 0 1 0 0 4 0 0 0 0 0 0 0 0 0 0 0 3 0 4
ath-miR5640 UGAGAGAAGGAAUUAGAUUCA 21 112 11 31 2    2 0 4 0 0 0 0 0 0 4 0 0 0 0 0 0 9 0 0 0 0 21 18 31 2 13 8
ath-miR5641 UGGAAGAAGAUGAUAGAAUUA 21 2 1 1 1    1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5642a UCUCGCGCUUGUACGGCUUU 20 511 30 192 3    15 14 10 4 0 0 0 3 0 97 10 7 192 0 18 0 0 0 0 0 22 18 29 20 23 7 22
ath-miR5642b UCUCGCGCUUGUACGGCUUU 20 511 30 192 3    15 14 10 4 0 0 0 3 0 97 10 7 192 0 18 0 0 0 0 0 22 18 29 20 23 7 22
ath-miR5643a AGGCUUUUAAGAUCUGGUUGC 21 2,582 136 644 6    542 206 204 42 8 41 0 0 11 595 10 69 644 26 130 0 0 0 0 0 0 13 11 8 6 6 10
ath-miR5643b AGGCUUUUAAGAUCUGGUUGC 21 2,582 136 644 6    542 206 204 42 8 41 0 0 11 595 10 69 644 26 130 0 0 0 0 0 0 13 11 8 6 6 10
ath-miR5644 GUGGGUUGCGGAUAACGGUA 20 23 4 7 1    1 0 0 6 0 0 0 7 0 0 5 0 0 3 0 0 0 0 0 0 0 1 0 0 0 0 0
ath-miR5645a AUUUGAGUCAUGUCGUUAAG 20 1 1 1 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5645b AUUUGAGUCAUGUCGUUAAG 20 1 1 1 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5645c AACCUAUUUAACGACAUGACU 21 61 6 24 1    0 3 2 1 0 0 0 0 0 4 0 4 3 6 0 0 4 0 0 24 0 0 0 0 7 0 3
ath-miR5645d AUUUGAGUCAUGUCGUUAAG 20 1 1 1 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5645e AUUUGAGUCAUGUCGUUAAG 20 1 1 1 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5645f AUUUGAGUCAUGUCGUUAAG 20 1 1 1 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5646 GUUCGAGGCACGUUGGGAGG 20 9 3 6 1    0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 2
ath-miR5647 UCAAGUUUGAUGACGAUUCCA 21 72 18 68 1    1 0 0 0 0 0 0 0 0 1 0 0 2 0 0 0 0 68 0 0 0 0 0 0 0 0 0
ath-miR5648-3p AUCUGAAGAAAAUAGCGGCAU 21 31 5 18 1    1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 18 0 0 0 0 0 0 7 0 0 3 1
ath-miR5648-5p UUUGGAAAUAUUUGGCUUGACU 22 23 3 5 1    1 0 3 0 0 0 0 3 0 4 5 0 1 0 0 0 0 0 0 0 0 1 5 0 0 0 0
ath-miR5649a AUUGAAUAUGUUGGUUACUAU 21 1 1 1 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5649b AUUGAAUAUGUUGGUUACUAU 21 1 1 1 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5650 UUGUUUUGGAUCUUAGAUACA 21 89 22 41 4    0 0 0 4 0 41 0 0 0 0 26 0 0 18 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5651 UUGUGCGGUUCAAAUAGUAAC 21 675 38 128 1    13 20 25 1 0 0 0 0 0 17 15 0 14 3 2 47 13 0 5 0 0 114 128 78 53 74 53
ath-miR5652 UUGAAUGUGAAUGAAUCGGGC 21 1,181 91 222 5    7 5 13 0 0 0 0 0 0 0 0 0 0 0 0 125 0 222 39 0 108 67 162 35 104 171 123
ath-miR5653 UGGGUUGAGUUGAGUUGAGUUGGC 24 498 38 88 7    88 15 13 7 0 0 0 0 0 0 0 0 0 0 0 8 0 0 27 14 0 56 53 63 50 49 55
ath-miR5654-3p UGGAAGAUGCUUUGGGAUUUAUU 23 2,135 89 294 6    176 110 294 6 25 41 0 37 0 180 26 27 131 29 31 259 0 34 77 8 114 66 95 63 106 92 108
ath-miR5654-5p AUAAAUCCCAACAUCUUCCA 20 27 3 10 1    1 0 0 0 0 0 0 0 2 7 0 0 1 0 0 10 0 0 0 0 0 1 0 0 3 2 0
ath-miR5655 AAGUAGACACAUAAGAAGGAG 21 19 5 12 2    0 2 0 0 0 0 0 0 0 3 0 0 12 0 0 0 0 0 0 2 0 0 0 0 0 0 0
ath-miR5656 ACUGAAGUAGAGAUUGGGUUU 21 50 6 15 1    4 7 1 0 0 0 0 0 0 15 0 0 6 0 0 3 0 0 0 0 0 1 0 0 0 12 1
ath-miR5657 UGGACAAGGUUAGAUUUGGUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5658 AUGAUGAUGAUGAUGAUGAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5659 CGAUGAAGGUCUUUGGAACGGUA 23 309 21 97 1    97 58 37 30 17 0 0 13 5 1 0 0 2 3 0 0 0 0 0 0 0 13 0 20 4 4 5
ath-miR5660 CAGGUGGUUAGUGCAAUGGAA 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5661 AGAGGUACAUCAUGUAGUCUG 21 4 1 2 1    1 0 0 0 0 0 0 0 0 1 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5662 AGAGGUGACCAUUGGAGAUG 20 3 1 1 1    1 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5663-3p UGAGAAUGCAAAUCCUUAGCU 21 148 16 28 1    0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 11 0 0 22 28 11 20 27 27
ath-miR5663-5p AGCUAAGGAUUUGCAUUCUCA 21 187 12 61 1    9 2 17 1 0 0 0 0 0 61 5 7 43 6 13 0 0 0 0 0 0 2 9 0 3 5 4
ath-miR5664 AUAGUCAAUUUUAUCGGUCUG 21 5 3 3 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 2 0
ath-miR5665 UUGGUGGACAAGAUCUGGGAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5666 AUGGGACAUCGAGCAUUUAAU 21 15 3 5 1    0 0 0 0 0 0 0 0 0 2 0 0 3 0 0 5 0 0 0 0 0 1 0 0 0 4 0
ath-miR5995b ACAUAUGAUCUGCAUCUUUGC 21 859 57 175 1    38 88 37 1 17 0 0 3 0 155 15 137 175 47 114 0 0 17 0 0 0 0 0 0 8 0 7
ath-miR5996 UGACAUCCAGAUAGAAGCUUUG 22 9,451 788 6,373 3    500 172 266 3 0 0 0 10 0 1,752 72 82 6,373 50 160 0 0 0 11 0 0 0 0 0 0 0 0
ath-miR5997 UGAAACCAAGUAGCUAAAUAG 21 30 3 13 1    1 0 1 0 0 0 0 0 0 4 0 0 2 0 0 13 4 0 0 0 0 1 0 0 0 2 2
ath-miR5998a ACAGUUUGUGUUUUGUUUUGU 21 215 20 73 1    1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 26 4 0 2 0 0 11 73 9 31 29 28
ath-miR5998b ACAGUUUGUGUUUUGUUUUGU 21 215 20 73 1    1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 26 4 0 2 0 0 11 73 9 31 29 28
ath-miR5999 UCUUCACUAUUAGACGGACAA 21 7 2 3 1    0 0 0 0 0 0 0 0 0 1 0 0 2 0 0 0 0 0 0 0 0 1 0 0 0 0 3
ath-miR771 UGAGCCUCUGUGGUAGCCCUCA 22 4 2 2 2    0 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR773a UUUGCUUCCAGCUUUUGUCUC 21 8 2 3 1    0 0 1 0 0 0 0 0 0 2 0 0 3 0 2 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR773b-3p UUUGAUUCCAGCUUUUGUCUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR773b-5p GGCAAUAACUUGAGCAAACA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR774a UUGGUUACCCAUAUGGCCAUC 21 1 1 1 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR774b-3p CAUCCAUAUUUUCAUCUCGAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR774b-5p UGAGAUGAAGAUAUGGGUGAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR775 UUCGAUGUCUAGCAGUGCCA 20 5,076 221 740 1    68 156 67 1 25 41 0 0 0 605 26 77 381 35 123 205 17 0 154 10 41 466 740 299 399 695 445
ath-miR776 UCUAAGUCUUCUAUUGAUGUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR777 UACGCAUUGAGUUUCGUUGCUU 22 128 16 33 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 26 0 0 0 0 0 33 12 9 9 14 24
ath-miR778 UGGCUUGGUUUAUGUACACCG 21 2 2 2 2    0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR779.1 UUCUGCUAUGUUGCUGCUCAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR779.2 UGAUUGGAAAUUUCGUUGACU 21 1,886 86 320 1    38 27 33 1 17 0 0 3 0 88 26 11 37 12 22 52 13 0 20 2 0 175 305 165 320 233 286
ath-miR780.1 UCUAGCAGCUGUUGAGCAGGU 21 18 5 7 2    3 2 0 0 0 0 0 0 0 7 0 0 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR780.2 UUCUUCGUGAAUAUCUGGCAU 21 2 1 1 1    1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR781a UUAGAGUUUUCUGGAUACUUA 21 2,248 112 722 4    220 178 204 8 0 0 0 13 4 722 26 51 611 9 81 8 0 0 16 0 0 8 8 13 10 38 20
ath-miR781b UUAGAGUUUUCUGGAUACUUA 21 2,248 112 722 4    220 178 204 8 0 0 0 13 4 722 26 51 611 9 81 8 0 0 16 0 0 8 8 13 10 38 20
ath-miR782 ACAAACACCUUGGAUGUUCUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR8121 AAAGUAUAAUGGUUUAGUGGUUUG 24 246 21 65 1    1 2 5 0 0 0 0 0 0 0 0 0 0 0 0 16 0 0 9 5 0 22 65 21 30 45 25
ath-miR8165 AAUGGAGGCAAGUGUGAAGGA 21 130 12 25 1    23 15 7 1 0 0 0 0 0 6 0 2 17 0 0 0 0 0 16 0 0 12 0 25 0 6 0
ath-miR8166 AGAGAGUGUAGAAAGUUUCUCA 22 115 8 51 1    4 3 6 6 0 0 0 7 0 1 5 0 4 3 2 0 0 0 11 51 0 0 7 0 0 5 0
ath-miR8167a AGAUGUGGAGAUCGUGGGGAUG 22 253 16 45 3    15 7 3 45 25 0 0 10 0 5 0 0 5 0 0 10 0 0 0 10 0 8 37 15 23 14 21
ath-miR8167b AGAUGUGGAGAUCGUGGGGAUG 22 253 16 45 3    15 7 3 45 25 0 0 10 0 5 0 0 5 0 0 10 0 0 0 10 0 8 37 15 23 14 21
ath-miR8167c AGAUGUGGAGAUCGUGGGGAUG 22 253 16 45 3    15 7 3 45 25 0 0 10 0 5 0 0 5 0 0 10 0 0 0 10 0 8 37 15 23 14 21
ath-miR8167d AGAUGUGGAGAUCGUGGGGAUG 22 253 16 45 3    15 7 3 45 25 0 0 10 0 5 0 0 5 0 0 10 0 0 0 10 0 8 37 15 23 14 21
ath-miR8167e AGAUGUGGAGAUCGUGGGGAUG 22 253 16 45 3    15 7 3 45 25 0 0 10 0 5 0 0 5 0 0 10 0 0 0 10 0 8 37 15 23 14 21
ath-miR8167f AGAUGUGGAGAUCGUGGGGAUG 22 253 16 45 3    15 7 3 45 25 0 0 10 0 5 0 0 5 0 0 10 0 0 0 10 0 8 37 15 23 14 21
ath-miR8168 AGGUGCUGAGUGUGCUAGUGC 21 28 4 8 1    1 5 2 3 8 0 0 0 0 3 0 0 4 0 2 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR8169 AUAGACAGAGUCACUCACAGA 21 96 11 41 2    6 2 6 0 0 41 0 0 0 9 0 0 5 0 0 0 0 0 0 0 0 7 0 17 0 3 0
ath-miR8170-3p UUGCUUAAAGAUUUUCUAUGU 21 10 3 5 1    1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 3 0
ath-miR8170-5p AUAGCAAAUCGAUAAGCAAUG 21 5 3 3 2    0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0
ath-miR8171 AUAGGUGGGCCAGUGGUAGGA 21 67 6 16 1    16 10 5 4 0 0 0 0 2 7 0 0 7 0 0 0 0 0 9 0 0 1 5 0 0 0 1
ath-miR8172 AUGGAUCAUCUAGAUGGAGAU 21 13 3 5 1    3 2 5 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0
ath-miR8173 AUGUGCUGAUUCGAGGUGGGA 21 92 12 16 6    15 8 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 16 0 16 9 6 15
ath-miR8174 AUGUGUAUAGGGAAGCUAAUC 21 62 5 9 1    1 3 9 0 0 0 0 0 0 1 0 0 0 3 0 0 4 0 0 0 0 6 5 8 9 6 7
ath-miR8175 GAUCCCCGGCAACGGCGCCA 20 7,472 575 1,449 1    0 0 0 1 0 0 0 0 0 2 0 0 0 0 0 86 225 9 25 25 0 1,022 1,449 755 1,439 1,058 1,376
ath-miR8176 GGCCGGUGGUCGCGAGAGGGA 21 20 10 17 3    0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 17 0 0 0 0 0 0 0 0 0
ath-miR8177 GUGUGAUGAUGUGUCAUUUAUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR8178 UAACAGAGUAAUUGUACAGUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR8179 UGACUGCAUUAACUUGAUCGU 21 17 4 7 2    2 0 0 0 0 0 0 0 0 7 0 0 6 0 0 0 0 0 0 0 0 2 0 0 0 0 0
ath-miR8180 UGCGGUGCGGGAGAAGUGC 19 151 10 50 1    4 2 3 16 50 0 0 17 0 0 0 0 1 0 0 0 9 0 0 8 0 9 11 8 6 1 6
ath-miR8181 UGGGGGUGGGGGGGUGACAG 20 56 7 16 2    0 2 4 0 0 0 0 0 0 2 0 0 2 0 0 0 0 0 0 0 0 0 9 0 11 16 10
ath-miR8182 UUGUGUUGCGUUUCUGUUGAUU 22 4 4 4 4    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0
ath-miR8183 UUUAGUUGACGGAAUUGUGGC 21 987 52 170 3    41 36 7 3 0 0 0 0 0 18 5 13 29 6 9 57 0 0 14 0 73 110 70 51 138 137 170
ath-miR8184 UUUGGUCUGAUUACGAAUGUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR822-3p UGUGCAAAUGCUUUCUACAGG 21 424 25 62 1    19 32 47 7 17 0 0 13 0 1 0 0 1 0 2 0 0 43 0 20 0 19 16 24 56 62 45
ath-miR822-5p UGCGGGAAGCAUUUGCACAUG 21 22,386 1,018 4,907 2    104 184 446 3 0 41 0 7 4 3 0 2 2 0 0 560 78 539 213 229 486 3,837 2,120 1,599 3,208 3,814 4,907
ath-miR823 UGGGUGGUGAUCAUAUAAGAU 21 3,346 159 479 1    70 178 131 1 8 0 0 0 4 118 0 64 97 9 86 366 0 0 243 29 54 479 277 136 254 276 466
ath-miR824-3p CCUUCUCAUCGAUGGUCUAGA 21 6,114 322 1,073 5    43 97 138 0 0 0 0 0 0 315 5 22 130 0 61 67 9 68 0 25 108 702 678 641 1,073 891 1,041
ath-miR824-5p UAGACCAUUUGUGAGAAGGGA 21 5,554 252 808 1    31 70 148 1 0 0 0 3 0 237 0 69 200 44 105 374 48 145 240 59 191 432 808 498 672 557 622
ath-miR825 UUCUCAAGAAGGUGCAUGAAC 21 6,699 319 2,032 5    378 415 232 6 0 41 0 37 0 1,694 56 106 2,032 53 138 5 0 0 16 0 79 166 198 124 269 377 277
ath-miR826a UAGUCCGGUUUUGGAUACGUG 21 342 24 117 1    1 0 0 1 17 41 3 27 0 3 36 18 6 117 33 0 0 26 0 0 0 0 13 0 0 0 0
ath-miR826b UGGUUUUGGACACGUGAAAAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR827 UUAGAUGACCAUCAACAAACU 21 3,311 166 568 1    1 29 21 0 0 0 0 3 0 32 5 4 6 12 11 322 199 0 113 139 0 568 394 565 315 235 337
ath-miR828 UCUUGCUUAAAUGAGUAUUCCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR829-3p.1 AGCUCUGAUACCAAAUGAUGGAAU 24 227 45 206 1    1 0 2 0 8 206 0 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR829-3p.2 CAAAUUAAAGCUUCAAGGUAG 21 9 2 3 1    1 0 1 1 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 3 0
ath-miR829-5p ACUUUGAAGCUUUGAUUUGAA 21 541 36 165 3    4 3 20 11 17 165 0 64 4 15 56 11 6 129 0 0 0 0 0 0 32 0 4 0 0 0 0
ath-miR830-3p UAACUAUUUUGAGAAGAAGUG 21 55 5 10 1    3 8 9 0 0 0 0 0 0 6 0 0 2 0 0 10 0 0 0 5 0 1 0 0 4 2 5
ath-miR830-5p UCUUCUCCAAAUAGUUUAGGUU 22 118 8 30 1    1 2 5 0 0 0 0 0 0 7 0 2 9 3 9 18 0 0 30 0 0 1 15 0 2 10 4
ath-miR831-3p UGAUCUCUUCGUACUCUUCUUG 22 554 40 129 4    13 31 19 18 0 82 0 27 4 129 51 15 87 38 26 0 0 0 14 0 0 0 0 0 0 0 0
ath-miR831-5p AGAAGCGUACAAGGAGAUGAGG 22 6 1 1 1    0 0 1 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1
ath-miR832-3p UUGAUUCCCAAUCCAAGCAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR832-5p UGCUGGGAUCGGGAAUCGAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR833a-3p UAGACCGAUGUCAACAAACAAG 22 39 6 9 1    1 5 5 0 0 0 0 0 0 9 0 0 6 0 9 0 0 0 4 0 0 0 0 0 0 0 0
ath-miR833a-5p UGUUUGUUGUACUCGGUCUAGU 22 711 44 170 2    23 2 20 0 17 0 0 0 0 5 0 4 19 0 0 29 0 0 16 0 16 45 65 31 170 131 118
ath-miR833b UGUUUGUUGACAUCGGUCUAG 21 14 2 5 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 2 0 1 0 0 5 3 2
ath-miR834 UGGUAGCAGUAGCGGUGGUAA 21 18 4 14 1    1 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 14 0 0 0 0 0 0 0 1
ath-miR835-3p UGGAGAAGAUACGCAAGAAAG 21 20 3 5 1    1 0 1 0 0 0 0 0 0 2 0 2 3 0 2 0 0 0 0 0 0 0 0 0 4 0 5
ath-miR835-5p UUCUUGCAUAUGUUCUUUAUC 21 17 3 9 1    0 2 0 0 0 0 0 0 0 1 0 0 3 0 0 0 0 0 0 0 0 1 0 0 0 9 1
ath-miR836 UCCUGUGUUUCCUUUGAUGCGUGG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR837-3p AAACGAACAAAAAACUGAUGG 21 178 14 30 2    2 2 5 0 0 0 0 0 0 15 0 7 7 3 0 0 0 0 0 0 0 26 21 27 10 30 23
ath-miR837-5p AUCAGUUUCUUGUUCGUUUCA 21 40 4 12 1    1 12 6 0 0 0 0 0 0 6 5 0 3 3 0 0 0 0 0 0 0 1 0 0 0 3 0
ath-miR838 UUUUCUUCUACUUCUUGCACA 21 490 31 148 1    14 124 38 1 0 0 0 0 4 148 5 35 59 9 11 0 0 0 0 0 0 16 4 16 0 4 2
ath-miR839-5p UACCAACCUUUCAUCGUUCCC 21 486 44 93 1    1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 17 68 0 10 0 53 90 31 71 50 93
ath-miR840-3p UUGUUUAGGUCCCUUAGUUUC 21 345 27 55 2    6 5 19 0 0 0 0 0 0 2 0 0 0 0 0 10 0 26 14 0 0 41 55 32 42 44 49
ath-miR840-5p ACACUGAAGGACCUAAACUAAC 22 611 32 125 3    37 65 64 31 8 0 0 10 0 9 5 0 18 3 0 125 13 0 61 17 0 25 24 0 38 18 40
ath-miR841a-3p AUUUCUAGUGGGUCGUAUUCA 21 1,718 75 335 1    54 122 131 1 0 41 0 10 11 335 15 18 181 41 35 166 9 0 70 17 0 105 28 25 89 84 130
ath-miR841a-5p UACGAGCCACUUGAAACUGAA 21 1,444 66 244 1    68 49 65 1 0 0 0 0 2 244 10 9 219 3 13 145 0 34 129 44 22 100 29 11 41 67 139
ath-miR841b-3p CAAUUUCUAGUGGGUCGUAUU 21 613 36 145 2    64 121 29 4 0 41 0 3 4 145 10 11 114 3 46 0 0 0 0 0 0 0 4 0 6 2 6
ath-miR841b-5p UACGAGCCACUGGAAACUGAA 21 287 21 62 1    2 3 3 0 0 0 0 0 0 17 5 0 4 0 0 62 0 0 29 12 0 28 1 0 24 39 58
ath-miR842 UCAUGGUCAGAUCCGUCAUCC 21 170 13 42 1    2 0 0 1 0 0 0 0 0 6 0 0 9 3 0 8 13 0 0 0 0 22 15 3 17 42 29
ath-miR843 UUUAGGUCGAGCUUCAUUGGA 21 5,703 238 1,069 11    485 955 625 470 91 1,069 18 255 35 200 61 11 22 35 0 80 0 43 41 0 41 177 196 190 219 194 190
ath-miR844-3p UUAUAAGCCAUCUUACUAGUU 21 125 8 20 2    0 5 5 0 0 0 0 3 0 10 0 2 9 6 7 16 0 0 0 0 0 12 4 20 2 16 8
ath-miR844-5p UGGUAAGAUUGCUUAUAAGCU 21 47 7 18 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 10 0 0 0 0 0 18 1 7 0 5 5
ath-miR845a CGGCUCUGAUACCAAUUGAUG 21 1,363 85 289 3    69 65 98 78 8 0 220 13 5 261 61 31 289 117 42 0 0 0 0 0 0 3 0 0 0 0 3
ath-miR845b UCGCUCUGAUACCAAAUUGAUG 22 172 17 97 1    7 3 1 1 8 0 97 0 4 20 0 2 29 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR846-3p UUGAAUUGAAGUGCUUGAAUU 21 4,280 171 788 4    495 204 788 24 17 82 0 17 4 752 118 40 640 102 70 91 0 26 29 5 16 158 218 113 76 99 96
ath-miR846-5p CAUUCAAGGACUUCUAUUCAG 21 3,568 274 901 2    6 25 11 0 0 0 0 0 0 0 0 0 0 3 0 13 0 0 2 0 10 680 775 901 306 593 243
ath-miR847 UCACUCCUCUUCUUCUUGAUG 21 1,640 71 356 1    72 270 91 1 0 0 0 3 4 356 5 97 239 23 86 140 4 9 16 15 0 77 9 46 13 22 42
ath-miR848 UGACAUGGGACUGCCUAAGCUA 22 557 28 67 3    19 24 28 4 0 0 0 3 0 67 10 0 57 6 9 54 0 26 11 10 0 45 30 35 32 51 36
ath-miR849 UAACUAAACAUUGGUGUAGUA 21 9 2 4 1    0 2 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 1 4 0 0 0 0
ath-miR850 UAAGAUCCGGACUACAACAAAG 22 1,529 90 798 1    94 46 31 1 0 0 0 0 0 288 15 18 798 6 29 10 0 0 0 29 0 28 16 0 31 23 66
ath-miR851-3p UGGGUGGCAAACAAAGACGAC 21 21 4 5 2    2 3 0 0 0 0 0 0 0 4 0 0 5 0 0 0 0 0 0 0 0 0 0 0 4 0 3
ath-miR851-5p UCUCGGUUCGCGAUCCACAAG 21 37 4 8 1    1 7 5 0 0 0 0 0 0 8 0 0 4 0 2 3 0 0 0 0 0 1 0 0 2 0 4
ath-miR852 AAGAUAAGCGCCUUAGUUCUG 21 653 36 212 2    19 37 61 3 0 0 0 10 2 212 0 13 70 12 2 3 0 0 0 0 0 29 33 6 48 27 66
ath-miR853 UCCCCUCUUUAGCUUGGAGAAG 22 17 3 7 1    0 0 1 0 0 0 0 0 0 2 0 7 1 0 0 5 0 0 0 0 0 0 0 0 0 0 1
ath-miR854a GAUGAGGAUAGGGAGGAGGAG 21 12 6 8 4    0 0 0 4 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR854b GAUGAGGAUAGGGAGGAGGAG 21 12 6 8 4    0 0 0 4 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR854c GAUGAGGAUAGGGAGGAGGAG 21 12 6 8 4    0 0 0 4 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR854d GAUGAGGAUAGGGAGGAGGAG 21 12 6 8 4    0 0 0 4 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR854e GAUGAGGAUAGGGAGGAGGAG 21 12 6 8 4    0 0 0 4 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR855 AGCAAAAGCUAAGGAAAAGGAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR856 UAAUCCUACCAAUAACUUCAGC 22 1 1 1 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR857 UUUUGUAUGUUGAAGGUGUAU 21 24 3 8 1    1 0 8 0 0 0 0 0 0 1 5 0 3 0 0 0 0 0 0 0 0 5 0 0 0 0 1
ath-miR858a UUUCGUUGUCUGUUCGACCUU 21 921 42 245 1    12 17 13 1 8 41 0 10 0 145 87 18 245 73 46 18 0 68 0 0 35 15 21 22 12 6 8
ath-miR858b UUCGUUGUCUGUUCGACCUUG 21 490 26 87 3    4 3 10 0 0 0 0 0 0 41 0 4 87 41 26 18 4 77 4 0 25 37 26 35 8 30 10
ath-miR859 UCUCUCUGUUGUGAAGUCAAA 21 48 5 9 1    1 0 0 0 0 0 0 0 0 5 0 0 4 0 0 0 0 0 0 0 0 3 3 8 7 9 8
ath-miR860 UCAAUAGAUUGGACUAUGUAU 21 264 19 83 2    7 3 2 0 0 0 0 0 0 66 0 2 83 0 22 8 0 0 0 0 0 19 12 13 8 8 11
ath-miR861-3p GAUGGAUAUGUCUUCAAGGAC 21 1,160 55 169 2    35 59 57 14 0 0 0 3 2 56 20 7 22 61 4 0 9 0 2 7 0 169 150 162 114 92 115
ath-miR861-5p CCUUGGAGAAAUAUGCGUCAA 21 11 2 5 1    0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 3 5
ath-miR862-3p AUAUGCUGGAUCUACUUGAAG 21 12 3 6 1    1 0 0 0 0 0 0 0 0 4 0 0 6 0 0 0 0 0 0 0 0 1 0 0 0 0 0
ath-miR862-5p UCCAAUAGGUCGAGCAUGUGC 21 322 20 68 5    7 10 9 0 0 0 0 0 0 68 5 7 51 9 11 0 0 0 0 0 38 11 21 21 23 11 20
ath-miR863-3p UUGAGAGCAACAAGACAUAAU 21 816 51 187 4    13 17 23 0 0 0 0 0 0 55 0 4 24 0 4 187 0 0 100 14 0 102 65 40 50 23 95
ath-miR863-5p UUAUGUCUUGUUGAUCUCAAU 21 556 35 214 1    27 34 18 1 0 0 0 0 2 106 0 20 214 0 4 42 0 0 20 0 0 8 20 0 9 14 17
ath-miR864-3p UAAAGUCAAUAAUACCUUGAAG 22 6 2 3 1    0 0 1 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0
ath-miR864-5p UCAGGUAUGAUUGACUUCAAA 21 42 5 15 1    0 7 7 0 0 0 0 0 0 15 0 0 4 0 0 0 0 0 2 0 0 1 0 0 0 4 2
ath-miR865-3p UUUUUCCUCAAAUUUAUCCAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR865-5p AUGAAUUUGGAUCUAAUUGAG 21 192 15 47 1    24 24 26 1 0 0 0 0 7 47 0 0 21 0 4 0 4 0 0 0 0 0 9 0 4 14 7
ath-miR866-3p ACAAAAUCCGUCUUUGAAGA 20 1,741 76 279 4    49 129 36 173 50 165 15 20 5 279 210 35 98 216 33 8 4 0 0 0 0 35 80 44 26 16 15
ath-miR866-5p UCAAGGAACGGAUUUUGUUAA 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
ath-miR867 UUGAACAUGGUUUAUUAGGAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR868-3p CUUCUUAAGUGCUGAUAAUGC 21 18 9 10 8    0 0 0 0 0 0 0 0 0 0