About This Database    FAQs   Our Collaborators

Annotated species Ustilago maydis Annotation built on JGI 2.0 Total number of genes 21,705
Library type RNA-seq Total bp in genome 19,765,606 Protein coding 6,826
Total number of libraries 10 Total chrs or contigs 25 Transposon related 14,879

The RNA-seq data on this site are from Ustilago-infected maize anthers; the libraries are predominantly from work performed in the Walbot lab at Stanford University, published in The Plant Cell.

Some data contributed by: Virginia Walbot (Stanford University).

Access to this web site and the data contained herein are provided for research purposes only. No commercial rights of any nature are granted.

Basic Queries

Please enter specific information to retrieve data.
Adjust libraries/reads to display on the control panel (optional).

Protein or gene ID
Bulk Query

e.g. um06480
Cluster or coordinate ID
Bulk Query

e.g. USTILAGO_MIT2.1.2001.500 (cluster)   USTILAGO_MIT2.1.2001.4500 (coordinate)
Sequence of RNA-seq read
Bulk Query
e.g. TCTACGAATGTCGACATCGAACTCCTCTTCTCTATGTCTGCGTCCGAAAA
Keyword for genes/proteins or repeats

e.g. MIRNA  LTR

Query by Chromosome Position

Click on a region of any chromosome for which you would like to retrieve the map. Because of the size of chromosomes, clicking on the diagram below will take you to a second map where you can refine the position. Note that if the genome has a mix of both chromosomes and small contigs or scaffolds, we only show images for the defined chromosomes, and contigs must be accessed via their ID.

0 - 1,000,0001,000,000 - 2,000,0002,000,000 - 2,476,5000 - 1,000,0001,000,000 - 1,879,3911,879,391 - 1,879,3910 - 1,000,0001,000,000 - 1,633,4721,633,472 - 1,633,4720 - 885,077885,077 - 885,077885,077 - 885,0770 - 1,000,0001,000,000 - 1,393,4181,393,418 - 1,393,4180 - 1,000,0001,000,000 - 1,031,3801,031,380 - 1,031,3800 - 957,188957,188 - 957,188957,188 - 957,1880 - 813,246813,246 - 813,246813,246 - 813,2460 - 733,964733,964 - 733,964733,964 - 733,9640 - 692,355692,355 - 692,355692,355 - 692,3550 - 690,617690,617 - 690,617690,617 - 690,6170 - 650,985650,985 - 650,985650,985 - 650,9850 - 606,072606,072 - 606,072606,072 - 606,0720 - 611,467611,467 - 611,467611,467 - 611,4670 - 575,418575,418 - 575,418575,418 - 575,4180 - 552,767552,767 - 552,767552,767 - 552,7670 - 576,627576,627 - 576,627576,627 - 576,6270 - 560,726560,726 - 560,726560,726 - 560,7260 - 571,809571,809 - 571,809571,809 - 571,8090 - 523,884523,884 - 523,884523,884 - 523,8840 - 470,506470,506 - 470,506470,506 - 470,5060 - 403,592403,592 - 403,592403,592 - 403,5920 - 344,927344,927 - 344,927344,927 - 344,9270 - 73,40473,404 - 73,40473,404 - 73,4040 - 56,81456,814 - 56,81456,814 - 56,814 Chromosome image

If you know the start and/or end of your genomic region, please enter one or both coordinates here to go directly to our chromosome viewer. If you only enter one coordinate, we use a default size of 100 kb for the viewer.