| Annotated species | Streptochaeta angustifolia | Annotation built on | ISU v1 | Total number of genes | 92,035 |
|---|---|---|---|---|---|
| Library type | PARE | Total bp in genome | 1,797,859,444 | Protein coding | 92,035 |
| Total number of libraries | 3 | Total chrs or contigs | 17,040 | Transposon related | 0 |
This is the outcome of several collaborative projects, including work with the labs of Matt Hufford (Iowa State Univ.) and Elizabeth Kellogg (DDPSC) to sequence, annotate, and analyze the Streptochaeta genome.
Some data contributed by: Elizabeth Kellogg (Donald Danforth Plant Science Center), Matthew Hufford (Iowa State University).
Access to this web site and the data contained herein are provided for research purposes only. No commercial rights of any nature are granted.
Please enter specific information to retrieve data.
Adjust libraries/reads to display on the control panel (optional).
| Protein or gene ID
Bulk Query |
e.g. STRANG_00000001 |
| Cluster or coordinate ID
Bulk Query |
e.g. STREPTOCHAETA_ISU1.1.2001.500 (cluster)
STREPTOCHAETA_ISU1.1.2001.4500 (coordinate)
|
| Sequence of PARE read
Bulk Query |
e.g. TACCTGATCATTTTGTGTGC
|
| Keyword for genes/proteins or repeats |
If you know the start and/or end of your genomic region, please enter one or both coordinates here to go directly to our chromosome viewer. If you only enter one coordinate, we use a default size of 100 kb for the viewer.