About This Database    FAQs   Our Collaborators

Annotated species Spirodela polyrhiza Annotation built on Leibniz-Institute of Plant Genetics and Crop Plant Research (IPK) 3.1 Total number of genes 19,828
Library type small RNA Total bp in genome 145,274,398 Protein coding 19,828
Total number of libraries 30 Total chrs or contigs 21 Transposon related 0

The Spirodela small RNA data on this site comes from libraries developed by collaborators at Rutgers University. The initial set of libraries were published by Fourounjian et al. the Plant Journal (2019) doi: 10.1111/tpj.14294.

Some data contributed by: Joachim Messing (Waksman Institute, Rutgers University).

Access to this web site and the data contained herein are provided for research purposes only. No commercial rights of any nature are granted.

Basic Queries

Please enter specific information to retrieve data.
Adjust libraries/reads to display on the control panel (optional).

Protein or gene ID
Bulk Query

e.g. Spipo23G0044400
Cluster or coordinate ID
Bulk Query

e.g. SPIRODELA_IPK3_1.1.2001.500 (cluster)   SPIRODELA_IPK3_1.1.2001.4500 (coordinate)
Sequence of small RNA read
Bulk Query
e.g. GCTTTTCAGCATGCGGCACAG
Keyword for genes/proteins or repeats

e.g. MIRNA  LTR

Query by Chromosome Position

Click on a region of any chromosome for which you would like to retrieve the map. Because of the size of chromosomes, clicking on the diagram below will take you to a second map where you can refine the position. Note that if the genome has a mix of both chromosomes and small contigs or scaffolds, we only show images for the defined chromosomes, and contigs must be accessed via their ID.

0 - 5,000,0005,000,000 - 10,000,00010,000,000 - 11,466,5340 - 5,000,0005,000,000 - 8,941,1728,941,172 - 8,941,1720 - 5,000,0005,000,000 - 8,796,1478,796,147 - 8,796,1470 - 5,000,0005,000,000 - 8,491,5008,491,500 - 8,491,5000 - 5,000,0005,000,000 - 8,389,6028,389,602 - 8,389,6020 - 5,000,0005,000,000 - 8,130,8748,130,874 - 8,130,8740 - 5,000,0005,000,000 - 8,107,5498,107,549 - 8,107,5490 - 5,000,0005,000,000 - 7,340,0197,340,019 - 7,340,0190 - 5,000,0005,000,000 - 7,208,0387,208,038 - 7,208,0380 - 5,000,0005,000,000 - 7,041,3137,041,313 - 7,041,3130 - 5,000,0005,000,000 - 6,552,8306,552,830 - 6,552,8300 - 5,000,0005,000,000 - 5,946,1785,946,178 - 5,946,1780 - 5,000,0005,000,000 - 5,476,6305,476,630 - 5,476,6300 - 5,000,0005,000,000 - 5,103,7055,103,705 - 5,103,7050 - 4,726,4294,726,429 - 4,726,4294,726,429 - 4,726,4290 - 4,623,6104,623,610 - 4,623,6104,623,610 - 4,623,6100 - 4,564,6094,564,609 - 4,564,6094,564,609 - 4,564,6090 - 4,370,2694,370,269 - 4,370,2694,370,269 - 4,370,2690 - 3,727,8093,727,809 - 3,727,8093,727,809 - 3,727,8090 - 3,541,2573,541,257 - 3,541,2573,541,257 - 3,541,2570 - 5,000,0005,000,000 - 10,000,00010,000,000 - 12,728,324 Chromosome image

If you know the start and/or end of your genomic region, please enter one or both coordinates here to go directly to our chromosome viewer. If you only enter one coordinate, we use a default size of 100 kb for the viewer.