About This Database    FAQs   Our Collaborators

Annotated species Rosa chinensis Annotation built on Total number of genes 50,387
Library type RNA-seq Total bp in genome 515,611,473 Protein coding 50,387
Total number of libraries 8 Total chrs or contigs 10 Transposon related 0

This website and the RNA-seq data contained therein are the outcome of dissertation work by Suresh Pokhrel during his time in the Meyers lab, as well as a collaborative project with Elena Kramer at Harvard University to sequence, annotate, and analyze RNA-seq data in rose. Additional data may have been added from public sources.

Some data contributed by: Elena Kramer (Harvard University).

Access to this web site and the data contained herein are provided for research purposes only. No commercial rights of any nature are granted.

Basic Queries

Please enter specific information to retrieve data.
Adjust libraries/reads to display on the control panel (optional).

Protein or gene ID
Bulk Query

e.g. RcHm_v2.0_Chr1g0312971
Cluster or coordinate ID
Bulk Query

e.g. ROSA_GDR2.1.2001.500 (cluster)   ROSA_GDR2.1.2001.4500 (coordinate)
Sequence of RNA-seq read
Bulk Query
e.g. CCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACC
Keyword for genes/proteins or repeats

e.g. MIRNA  LTR

Query by Chromosome Position

Click on a region of any chromosome for which you would like to retrieve the map. Because of the size of chromosomes, clicking on the diagram below will take you to a second map where you can refine the position. Note that if the genome has a mix of both chromosomes and small contigs or scaffolds, we only show images for the defined chromosomes, and contigs must be accessed via their ID.

0 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 60,000,00060,000,000 - 68,490,20268,490,202 - 68,490,20268,490,202 - 68,490,2020 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 60,000,00060,000,000 - 70,000,00070,000,000 - 80,000,00080,000,000 - 88,556,3290 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 49,737,31249,737,312 - 49,737,31249,737,312 - 49,737,31249,737,312 - 49,737,31249,737,312 - 49,737,3120 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 60,000,00060,000,000 - 67,241,32467,241,324 - 67,241,32467,241,324 - 67,241,3240 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 60,000,00060,000,000 - 70,000,00070,000,000 - 80,000,00080,000,000 - 89,953,7960 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 60,000,00060,000,000 - 69,643,16569,643,165 - 69,643,16569,643,165 - 69,643,1650 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 60,000,00060,000,000 - 70,000,00070,000,000 - 70,290,80070,290,800 - 70,290,8000 - 156,546156,546 - 156,546156,546 - 156,546156,546 - 156,546156,546 - 156,546156,546 - 156,546156,546 - 156,546156,546 - 156,546156,546 - 156,5460 - 313,448313,448 - 313,448313,448 - 313,448313,448 - 313,448313,448 - 313,448313,448 - 313,448313,448 - 313,448313,448 - 313,448313,448 - 313,4480 - 10,000,00010,000,000 - 11,228,55111,228,551 - 11,228,55111,228,551 - 11,228,55111,228,551 - 11,228,55111,228,551 - 11,228,55111,228,551 - 11,228,55111,228,551 - 11,228,55111,228,551 - 11,228,551 Chromosome image

If you know the start and/or end of your genomic region, please enter one or both coordinates here to go directly to our chromosome viewer. If you only enter one coordinate, we use a default size of 100 kb for the viewer.