About This Database    FAQs

Annotated species Oryza punctata Annotation built on Oryza Genome Evolution (OGE) Project 1.2 Total number of genes 32,550
Library type small RNA Total bp in genome 394,441,648 Protein coding 32,550
Total number of libraries 1 Total chrs or contigs 14 Transposon related 0

The Oryza punctata small RNA data on this site comes from public sources such as those submitted to Genbank from published papers.

Access to this web site and the data contained herein are provided for research purposes only. No commercial rights of any nature are granted.

Basic Queries

Please enter specific information to retrieve data.
Adjust libraries/reads to display on the control panel (optional).

Protein or gene ID
Bulk Query

e.g. OPUNC01G00010
Cluster or coordinate ID
Bulk Query

e.g. OPUNCTATA_OGE1_2.1.2001.500 (cluster)   OPUNCTATA_OGE1_2.1.2001.4500 (coordinate)
Sequence of small RNA read
Bulk Query
e.g. AAAAGGACTTTGAAAAGAGAGTCA
Keyword for genes/proteins or repeats

e.g. MIRNA  LTR

Query by Chromosome Position

Click on a region of any chromosome for which you would like to retrieve the map. Because of the size of chromosomes, clicking on the diagram below will take you to a second map where you can refine the position. Note that if the genome has a mix of both chromosomes and small contigs or scaffolds, we only show images for the defined chromosomes, and contigs must be accessed via their ID.

0 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 30,000,00030,000,000 - 35,000,00035,000,000 - 40,000,00040,000,000 - 45,000,00045,000,000 - 46,096,7430 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 30,000,00030,000,000 - 35,000,00035,000,000 - 39,559,43339,559,433 - 39,559,43339,559,433 - 39,559,4330 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 30,000,00030,000,000 - 35,000,00035,000,000 - 38,925,37738,925,377 - 38,925,37738,925,377 - 38,925,3770 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 30,000,00030,000,000 - 33,711,90333,711,903 - 33,711,90333,711,903 - 33,711,90333,711,903 - 33,711,9030 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 30,000,00030,000,000 - 31,082,98131,082,981 - 31,082,98131,082,981 - 31,082,98131,082,981 - 31,082,9810 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 30,000,00030,000,000 - 34,615,99234,615,992 - 34,615,99234,615,992 - 34,615,99234,615,992 - 34,615,9920 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 30,000,00030,000,000 - 31,244,61031,244,610 - 31,244,61031,244,610 - 31,244,61031,244,610 - 31,244,6100 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 29,853,97329,853,973 - 29,853,97329,853,973 - 29,853,97329,853,973 - 29,853,97329,853,973 - 29,853,9730 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 26,294,01726,294,017 - 26,294,01726,294,017 - 26,294,01726,294,017 - 26,294,01726,294,017 - 26,294,0170 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 25,992,11925,992,119 - 25,992,11925,992,119 - 25,992,11925,992,119 - 25,992,11925,992,119 - 25,992,1190 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 28,494,62028,494,620 - 28,494,62028,494,620 - 28,494,62028,494,620 - 28,494,62028,494,620 - 28,494,6200 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 27,944,83527,944,835 - 27,944,83527,944,835 - 27,944,83527,944,835 - 27,944,83527,944,835 - 27,944,8350 - 134,525134,525 - 134,525134,525 - 134,525134,525 - 134,525134,525 - 134,525134,525 - 134,525134,525 - 134,525134,525 - 134,525134,525 - 134,525134,525 - 134,5250 - 490,520490,520 - 490,520490,520 - 490,520490,520 - 490,520490,520 - 490,520490,520 - 490,520490,520 - 490,520490,520 - 490,520490,520 - 490,520490,520 - 490,520 Chromosome image

If you know the start and/or end of your genomic region, please enter one or both coordinates here to go directly to our chromosome viewer. If you only enter one coordinate, we use a default size of 100 kb for the viewer.