About This Database    FAQs

Annotated species Medicago truncatula Annotation built on JCVI 3.5 Total number of genes 57,520
Library type PARE Total bp in genome 314,426,444 Protein coding 47,290
Total number of libraries 3 Total chrs or contigs 9 Transposon related 10,230

The PARE ("Parallel Analysis of RNA Ends") website contains data from cleaved mRNAs, also known as “degradome” sequencing. Many high abundance reads in this dataset are from miRNA target sites, while the far greater number of diverse, low abundances sequences are the products of mRNA decay and are not miRNA-directed cleavage products. But these strand-specific data are also useful for examining transcripts in a qualitative manner. The data on this site are from both project in which we have participated, plus data from Genbank.

Access to this web site and the data contained herein are provided for research purposes only. No commercial rights of any nature are granted.

Basic Queries

Please enter specific information to retrieve data.
Adjust libraries/reads to display on the control panel (optional).

Protein or gene ID
Bulk Query

e.g. Medtr1g005000
Cluster or coordinate ID
Bulk Query

e.g. MT_MIPS3_5.1.2001.500 (cluster)   MT_MIPS3_5.1.2001.4500 (coordinate)
Sequence of PARE read
Bulk Query
e.g. ACCAACATCGAAAGAAAGTG
Keyword for genes/proteins or repeats

e.g. MIRNA  LTR

Query by Chromosome Position

Click on a region of any chromosome for which you would like to retrieve the map. Because of the size of chromosomes, clicking on the diagram below will take you to a second map where you can refine the position. Note that if the genome has a mix of both chromosomes and small contigs or scaffolds, we only show images for the defined chromosomes, and contigs must be accessed via their ID.

0 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 30,000,00030,000,000 - 34,297,68434,297,684 - 34,297,68434,297,684 - 34,297,68434,297,684 - 34,297,6840 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 30,000,00030,000,000 - 34,376,03534,376,035 - 34,376,03534,376,035 - 34,376,03534,376,035 - 34,376,0350 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 30,000,00030,000,000 - 35,000,00035,000,000 - 40,000,00040,000,000 - 43,359,09643,359,096 - 43,359,0960 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 30,000,00030,000,000 - 35,000,00035,000,000 - 40,000,00040,000,000 - 45,000,00045,000,000 - 47,685,3680 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 30,000,00030,000,000 - 35,000,00035,000,000 - 40,000,00040,000,000 - 42,630,29742,630,297 - 42,630,2970 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 23,282,16223,282,162 - 23,282,16223,282,162 - 23,282,16223,282,162 - 23,282,16223,282,162 - 23,282,16223,282,162 - 23,282,1620 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 30,000,00030,000,000 - 35,000,00035,000,000 - 38,853,26238,853,262 - 38,853,26238,853,262 - 38,853,2620 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 30,000,00030,000,000 - 32,567,58032,567,580 - 32,567,58032,567,580 - 32,567,58032,567,580 - 32,567,5800 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 17,374,96017,374,960 - 17,374,96017,374,960 - 17,374,96017,374,960 - 17,374,96017,374,960 - 17,374,96017,374,960 - 17,374,96017,374,960 - 17,374,960 Chromosome image

If you know the start and/or end of your genomic region, please enter one or both coordinates here to go directly to our chromosome viewer. If you only enter one coordinate, we use a default size of 100 kb for the viewer.