About This Database    FAQs   Our Collaborators

Annotated species Zea mays (B73) Annotation built on Maize Genetics and Genomics Database v5 Total number of genes 914,018
Library type RNA-seq Total bp in genome 2,183,123,008 Protein coding 47,555
Total number of libraries 24 Total chrs or contigs 13 Transposon related 866,463

The maize RNA-seq data on this site comes from our own libraries, which were published in bioRxiv. We used the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) Cas9 system to mutate Dcl5 in maize. To investigate transcriptional changes in the dcl5 mutants, RNA-seq libraries were constructed from anthers or spikelets of each dcl5 allele. Raw data were submitted to GEO under GSE122449 (including RNA-seq data as GSM3466701 to GSM3466714).

Some data contributed by: Virginia Walbot (Stanford University).

Access to this web site and the data contained herein are provided for research purposes only. No commercial rights of any nature are granted.

Basic Queries

Please enter specific information to retrieve data.
Adjust libraries/reads to display on the control panel (optional).

Protein or gene ID
Bulk Query

e.g. TE_homo_92
Cluster or coordinate ID
Bulk Query
Gramene assembly converter

e.g. MAIZE_B73v5.1.2001.500 (cluster)   MAIZE_B73v5.1.2001.4500 (coordinate)
Sequence of RNA-seq read
Bulk Query
e.g. CAGATTTTTGACCAAGAAATGGTCTCCACCAGAAATCCAAGAATGTGATC
Keyword for genes/proteins or repeats

e.g. MIRNA  LTR

Query by Chromosome Position

Click on a region of any chromosome for which you would like to retrieve the map. Because of the size of chromosomes, clicking on the diagram below will take you to a second map where you can refine the position. Note that if the genome has a mix of both chromosomes and small contigs or scaffolds, we only show images for the defined chromosomes, and contigs must be accessed via their ID.

0 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 60,000,00060,000,000 - 70,000,00070,000,000 - 80,000,00080,000,000 - 90,000,00090,000,000 - 100,000,000100,000,000 - 110,000,000110,000,000 - 120,000,000120,000,000 - 130,000,000130,000,000 - 140,000,000140,000,000 - 150,000,000150,000,000 - 160,000,000160,000,000 - 170,000,000170,000,000 - 180,000,000180,000,000 - 190,000,000190,000,000 - 200,000,000200,000,000 - 210,000,000210,000,000 - 220,000,000220,000,000 - 230,000,000230,000,000 - 240,000,000240,000,000 - 250,000,000250,000,000 - 260,000,000260,000,000 - 270,000,000270,000,000 - 280,000,000280,000,000 - 290,000,000290,000,000 - 300,000,000300,000,000 - 308,452,4710 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 60,000,00060,000,000 - 70,000,00070,000,000 - 80,000,00080,000,000 - 90,000,00090,000,000 - 100,000,000100,000,000 - 110,000,000110,000,000 - 120,000,000120,000,000 - 130,000,000130,000,000 - 140,000,000140,000,000 - 150,000,000150,000,000 - 160,000,000160,000,000 - 170,000,000170,000,000 - 180,000,000180,000,000 - 190,000,000190,000,000 - 200,000,000200,000,000 - 210,000,000210,000,000 - 220,000,000220,000,000 - 230,000,000230,000,000 - 240,000,000240,000,000 - 243,675,191243,675,191 - 243,675,191243,675,191 - 243,675,191243,675,191 - 243,675,191243,675,191 - 243,675,191243,675,191 - 243,675,191243,675,191 - 243,675,1910 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 60,000,00060,000,000 - 70,000,00070,000,000 - 80,000,00080,000,000 - 90,000,00090,000,000 - 100,000,000100,000,000 - 110,000,000110,000,000 - 120,000,000120,000,000 - 130,000,000130,000,000 - 140,000,000140,000,000 - 150,000,000150,000,000 - 160,000,000160,000,000 - 170,000,000170,000,000 - 180,000,000180,000,000 - 190,000,000190,000,000 - 200,000,000200,000,000 - 210,000,000210,000,000 - 220,000,000220,000,000 - 230,000,000230,000,000 - 238,017,767238,017,767 - 238,017,767238,017,767 - 238,017,767238,017,767 - 238,017,767238,017,767 - 238,017,767238,017,767 - 238,017,767238,017,767 - 238,017,767238,017,767 - 238,017,7670 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 60,000,00060,000,000 - 70,000,00070,000,000 - 80,000,00080,000,000 - 90,000,00090,000,000 - 100,000,000100,000,000 - 110,000,000110,000,000 - 120,000,000120,000,000 - 130,000,000130,000,000 - 140,000,000140,000,000 - 150,000,000150,000,000 - 160,000,000160,000,000 - 170,000,000170,000,000 - 180,000,000180,000,000 - 190,000,000190,000,000 - 200,000,000200,000,000 - 210,000,000210,000,000 - 220,000,000220,000,000 - 230,000,000230,000,000 - 240,000,000240,000,000 - 250,000,000250,000,000 - 250,330,460250,330,460 - 250,330,460250,330,460 - 250,330,460250,330,460 - 250,330,460250,330,460 - 250,330,460250,330,460 - 250,330,4600 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 60,000,00060,000,000 - 70,000,00070,000,000 - 80,000,00080,000,000 - 90,000,00090,000,000 - 100,000,000100,000,000 - 110,000,000110,000,000 - 120,000,000120,000,000 - 130,000,000130,000,000 - 140,000,000140,000,000 - 150,000,000150,000,000 - 160,000,000160,000,000 - 170,000,000170,000,000 - 180,000,000180,000,000 - 190,000,000190,000,000 - 200,000,000200,000,000 - 210,000,000210,000,000 - 220,000,000220,000,000 - 226,353,449226,353,449 - 226,353,449226,353,449 - 226,353,449226,353,449 - 226,353,449226,353,449 - 226,353,449226,353,449 - 226,353,449226,353,449 - 226,353,449226,353,449 - 226,353,449226,353,449 - 226,353,4490 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 60,000,00060,000,000 - 70,000,00070,000,000 - 80,000,00080,000,000 - 90,000,00090,000,000 - 100,000,000100,000,000 - 110,000,000110,000,000 - 120,000,000120,000,000 - 130,000,000130,000,000 - 140,000,000140,000,000 - 150,000,000150,000,000 - 160,000,000160,000,000 - 170,000,000170,000,000 - 180,000,000180,000,000 - 181,357,234181,357,234 - 181,357,234181,357,234 - 181,357,234181,357,234 - 181,357,234181,357,234 - 181,357,234181,357,234 - 181,357,234181,357,234 - 181,357,234181,357,234 - 181,357,234181,357,234 - 181,357,234181,357,234 - 181,357,234181,357,234 - 181,357,234181,357,234 - 181,357,234181,357,234 - 181,357,2340 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 60,000,00060,000,000 - 70,000,00070,000,000 - 80,000,00080,000,000 - 90,000,00090,000,000 - 100,000,000100,000,000 - 110,000,000110,000,000 - 120,000,000120,000,000 - 130,000,000130,000,000 - 140,000,000140,000,000 - 150,000,000150,000,000 - 160,000,000160,000,000 - 170,000,000170,000,000 - 180,000,000180,000,000 - 185,808,916185,808,916 - 185,808,916185,808,916 - 185,808,916185,808,916 - 185,808,916185,808,916 - 185,808,916185,808,916 - 185,808,916185,808,916 - 185,808,916185,808,916 - 185,808,916185,808,916 - 185,808,916185,808,916 - 185,808,916185,808,916 - 185,808,916185,808,916 - 185,808,916185,808,916 - 185,808,9160 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 60,000,00060,000,000 - 70,000,00070,000,000 - 80,000,00080,000,000 - 90,000,00090,000,000 - 100,000,000100,000,000 - 110,000,000110,000,000 - 120,000,000120,000,000 - 130,000,000130,000,000 - 140,000,000140,000,000 - 150,000,000150,000,000 - 160,000,000160,000,000 - 170,000,000170,000,000 - 180,000,000180,000,000 - 182,411,202182,411,202 - 182,411,202182,411,202 - 182,411,202182,411,202 - 182,411,202182,411,202 - 182,411,202182,411,202 - 182,411,202182,411,202 - 182,411,202182,411,202 - 182,411,202182,411,202 - 182,411,202182,411,202 - 182,411,202182,411,202 - 182,411,202182,411,202 - 182,411,202182,411,202 - 182,411,2020 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 60,000,00060,000,000 - 70,000,00070,000,000 - 80,000,00080,000,000 - 90,000,00090,000,000 - 100,000,000100,000,000 - 110,000,000110,000,000 - 120,000,000120,000,000 - 130,000,000130,000,000 - 140,000,000140,000,000 - 150,000,000150,000,000 - 160,000,000160,000,000 - 163,004,744163,004,744 - 163,004,744163,004,744 - 163,004,744163,004,744 - 163,004,744163,004,744 - 163,004,744163,004,744 - 163,004,744163,004,744 - 163,004,744163,004,744 - 163,004,744163,004,744 - 163,004,744163,004,744 - 163,004,744163,004,744 - 163,004,744163,004,744 - 163,004,744163,004,744 - 163,004,744163,004,744 - 163,004,744163,004,744 - 163,004,7440 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 60,000,00060,000,000 - 70,000,00070,000,000 - 80,000,00080,000,000 - 90,000,00090,000,000 - 100,000,000100,000,000 - 110,000,000110,000,000 - 120,000,000120,000,000 - 130,000,000130,000,000 - 140,000,000140,000,000 - 150,000,000150,000,000 - 152,435,371152,435,371 - 152,435,371152,435,371 - 152,435,371152,435,371 - 152,435,371152,435,371 - 152,435,371152,435,371 - 152,435,371152,435,371 - 152,435,371152,435,371 - 152,435,371152,435,371 - 152,435,371152,435,371 - 152,435,371152,435,371 - 152,435,371152,435,371 - 152,435,371152,435,371 - 152,435,371152,435,371 - 152,435,371152,435,371 - 152,435,371152,435,371 - 152,435,3710 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,1890 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,3840 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630 Chromosome image

If you know the start and/or end of your genomic region, please enter one or both coordinates here to go directly to our chromosome viewer. If you only enter one coordinate, we use a default size of 100 kb for the viewer.