About This Database    FAQs   Our Collaborators

Annotated species Brachypodium distachyon Annotation built on JGI v3.1 Total number of genes 35,122
Library type PARE Total bp in genome 271,164,919 Protein coding 35,122
Total number of libraries 18 Total chrs or contigs 7 Transposon related 0

The PARE ("Parallel Analysis of RNA Ends") website contains data from cleaved mRNAs, also known as “degradome” sequencing. Many high abundance reads in this dataset are from miRNA target sites, while the far greater number of diverse, low abundances sequences are the products of mRNA decay and are not miRNA-directed cleavage products. But these strand-specific data are also useful for examining transcripts in a qualitative manner.

Brachypodium research in the Green lab was funded by the Plant Feedstocks Genomics for Bioenergy Program of the Department of Energy through grant #DE-FG02-07ER64450 to PJG which also contributed to the support of this database.

Some data contributed by: Pamela Green (Delaware Biotechnology Institute, University of Delaware).

Access to this web site and the data contained herein are provided for research purposes only. No commercial rights of any nature are granted.

Basic Queries

Please enter specific information to retrieve data.
Adjust libraries/reads to display on the control panel (optional).

Protein or gene ID
Bulk Query

e.g. Bradi1g00200
Cluster or coordinate ID
Bulk Query

e.g. BRACHY_JGI3.1.2001.500 (cluster)   BRACHY_JGI3.1.2001.4500 (coordinate)
Sequence of PARE read
Bulk Query
e.g. AGATCTAGTCGGTGCCTGCT
Keyword for genes/proteins or repeats

e.g. MIRNA  LTR

Query by Chromosome Position

Click on a region of any chromosome for which you would like to retrieve the map. Because of the size of chromosomes, clicking on the diagram below will take you to a second map where you can refine the position. Note that if the genome has a mix of both chromosomes and small contigs or scaffolds, we only show images for the defined chromosomes, and contigs must be accessed via their ID.

0 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 60,000,00060,000,000 - 70,000,00070,000,000 - 75,071,5450 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 59,130,57559,130,575 - 59,130,57559,130,575 - 59,130,5750 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 59,640,14559,640,145 - 59,640,14559,640,145 - 59,640,1450 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 48,594,89448,594,894 - 48,594,89448,594,894 - 48,594,89448,594,894 - 48,594,8940 - 10,000,00010,000,000 - 20,000,00020,000,000 - 28,630,13628,630,136 - 28,630,13628,630,136 - 28,630,13628,630,136 - 28,630,13628,630,136 - 28,630,13628,630,136 - 28,630,1360 - 46,18446,184 - 46,18446,184 - 46,18446,184 - 46,18446,184 - 46,18446,184 - 46,18446,184 - 46,18446,184 - 46,1840 - 51,44051,440 - 51,44051,440 - 51,44051,440 - 51,44051,440 - 51,44051,440 - 51,44051,440 - 51,44051,440 - 51,440 Chromosome image

If you know the start and/or end of your genomic region, please enter one or both coordinates here to go directly to our chromosome viewer. If you only enter one coordinate, we use a default size of 100 kb for the viewer.