About This Database    FAQs   Our Collaborators

Annotated species Arabidopsis thaliana Annotation built on TAIR 10 Total number of genes 33,845
Library type PARE Total bp in genome 119,667,750 Protein coding 29,942
Total number of libraries 9 Total chrs or contigs 7 Transposon related 3,903

The PARE data on this site were described in a publication from the lab of Pam Green in Nucleic Acids Research.

Some data contributed by: Pamela Green (Delaware Biotechnology Institute, University of Delaware).

    known microRNAs: ath-miR167a      ath-miR172b
    known microRNA targets: At1g30490      At3g11440      At2g28350
  trans-acting siRNAs TAS1a      TAS1b      TAS1c      TAS2      TAS3a      TAS3b      TAS3c      TAS4

Access to this web site and the data contained herein are provided for research purposes only. No commercial rights of any nature are granted.

Basic Queries

Please enter specific information to retrieve data.
Adjust libraries/reads to display on the control panel (optional).

Protein or gene ID
Bulk Query

e.g. AT1G01010
Cluster or coordinate ID
Bulk Query

e.g. AT_TAIR10.1.2001.500 (cluster)   AT_TAIR10.1.2001.4500 (coordinate)
Sequence of PARE read
Bulk Query
e.g. AGGATTGGATTCTAATAAGT
Keyword for genes/proteins or repeats

e.g. MIRNA  LTR

Query by Chromosome Position

Click on a region of any chromosome for which you would like to retrieve the map. Because of the size of chromosomes, clicking on the diagram below will take you to a second map where you can refine the position. Note that if the genome has a mix of both chromosomes and small contigs or scaffolds, we only show images for the defined chromosomes, and contigs must be accessed via their ID.

0 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 30,000,00030,000,000 - 30,427,6710 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 19,698,28919,698,289 - 19,698,28919,698,289 - 19,698,28919,698,289 - 19,698,2890 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 23,459,83023,459,830 - 23,459,83023,459,830 - 23,459,8300 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 18,585,05618,585,056 - 18,585,05618,585,056 - 18,585,05618,585,056 - 18,585,0560 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 26,975,50226,975,502 - 26,975,5020 - 154,478154,478 - 154,478154,478 - 154,478154,478 - 154,478154,478 - 154,478154,478 - 154,478154,478 - 154,4780 - 366,924366,924 - 366,924366,924 - 366,924366,924 - 366,924366,924 - 366,924366,924 - 366,924366,924 - 366,924 Chromosome image

If you know the start and/or end of your genomic region, please enter one or both coordinates here to go directly to our chromosome viewer. If you only enter one coordinate, we use a default size of 100 kb for the viewer.